| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGACAGCCUAGCUGGACUUUGGGUGAGGCGGUUCAGCCAUGAGGCUG… | 1624 nt | 0.5597 | |
| GCAGACAGCCUAGCUGGACUUUGGGUGAGGCGGUUCAGCCAUGAGGCUG… | 1705 nt | 0.5584 |
This gene encodes a 110-kD transmembrane glycoprotein that is highly expressed by human monocytes and tissue macrophages. It is a member of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family. The protein primarily localizes to lysosomes and endosomes with a smaller fraction circulating to the cell surface. It is a type I integral membrane protein with a heavily glycosylated extracellular domain and binds to tissue- and organ-specific lectins or selectins. The protein is also a member of the scavenger receptor family. Scavenger receptors typically function to clear cellular debris, promote phagocytosis, and mediate the recruitment and activation of macrophages. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the CD68 transcript was upregulated 3.3-fold in the injured ipsilateral neocortex three days post-closed head injury, indicating its role as an integral membrane marker associated with inflammatory responses [Israelsson et al. DOI:10.1089/neu.2008.0676]. In human bioinformatics research, the CD68 gene was utilized as a marker for manual annotation of macrophage clusters in carotid atherosclerosis datasets, supporting its identification in specific immune cell populations [Xue et al. DOI:10.3233/JAD-230559]. In human traumatic brain injury, analysis of pericontusional tissue showed the CD68 mRNA was upregulated by 36% in one patient [Michael et al. DOI:10.1016/j.jocn.2004.11.003].