Basic Information

Symbol
CD69
RNA class
mRNA
Alias
CD69 Molecule CLEC2C CD69 Antigen (P60, Early T-Cell Activation Antigen) Early T-Cell Activation Antigen P60 Leukocyte Surface Antigen Leu-23 Early Activation Antigen CD69 BL-AC/P26 GP32/28 MLR-3 AIM EA1 C-Type Lectin Domain Family 2, Member C Activation Inducer Molecule (AIM/CD69) C-Type Lectin Domain Family 2 Member C Early Lymphocyte Activation Antigen Activation Inducer Molecule CD69 Antigen
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_001781.2
Sequence length
1676.0 nt
GC content
0.3652

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-407.80 kcal/mol
Thermodynamic ensemble
Free energy: -441.17 kcal/mol
Frequency: 0.0000
Diversity: 473.78
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((...(((((.(((............))).)))))...))))((((((.(((...((((((((((.......)))))..(((.(((((....))))).)))........((((((((....))))))))((((.(((((...(((..(((((((...((((((......(((((....((((((((((.((((((.(((((((((((((.((....(((((.......)))))....)).)))))..((((..((((.((((..((((...((....))...))))...........((((((.((.((((..(((((((((...((.((.((((((.((((.((..((.((((.(((((((......))))))).))).).))..)).)))).))))))........)).))....))))))))).....)).)).)).))))))..)))).))))..))))...............)))))))...).))))))..(((((..(((((...........)))))))))))))))).))))..)))))...(((((........))))).(((((.(((.(((((.....(((((((((...)))))))))..(((((.(((((..(((((((((............(((((((((......(((((.......)))))..)))))))))....(((((((((....)))))...))))((.(((((((.......((((((((((.(((((.(((((((((.....)))))))))......((((.(((((((((((((((((..((((((((.....................))))))))))))))).......)))))))))).))))...)))))))))....)))))))))))))..)).....(((((((.....................((((.((...)).)))).....(((((((((.......))))))))).........))))))).))))).))))..)))))..)))))(((((((.....((((((((.(((....)))......))))).)))...)))))))..))))).))))))))......))))))...)))))))..)))...))))).)))).......)))))))).))))))..((((.((((((..((((...((((((((....((((((...((((((((.((.....((((((..(((((((..((((.((((((((((((((((.......))))(((.((.((((..(((.........((((((.(((....)))((((........)).)).....(((((((...(((((....)))))..(((((((........)))))))..)))))))...)))))))))..)))).)))))...........)))))))).))))...))))..)))))))))))))..))))))))))....))))))((((((((..((((........))))..))))))))..........................(((((((((...(((((........((((((((((((.....)))))).))))))....)))))..)))))..))))..)))))))))))))))))).))))........................
Thermodynamic Ensemble Prediction
...,{({,,.,(((((,(((..{{....,,..}}}.))))}..,}}}.{(({{{......}}}},.{((((.......))))}}}|}}}|{,,..,{{{||{{{{{{{((((,,{{{|||||||...,{{||,{{((.{{,,,...,,.|||||},..}}},,,,{||||,.,..{,{,||,,|(((((.{(({.((((((.{((((((((((((.{(,{{.(((((.......))))).},.}}.)))))..((((.,((((.(((({(((({{{,...,}}))))}((((((,.{,..{(((((..((,,..((({(,...}}}}}....,.))..)))))).}},})))))).,(((.(((((((......))))))).))).|{{{((,{({,{.,,{((((..(({.....}))..))))}..,}}}})..))))).,,,,},..,,..)))).)))).,))))....,,......,..)))))))...}.))))))..}}))..))))){,{(((((,,((({,{(({,...(((((((((((..,(((((.((((........((({{((((.((((((((((((((...(((((((({...}))))))))...)))|(((((((....{((({,.....}}},}}.(((((((((......(((((.......)))))..))))))))).{(((((((....{((({.|..............))))))))))))})))))))|((((((...........)))))))))))))))))........,,,.{((,.((((((((..{(((((((............,........))))))))))))))))....}},..(((((((((((((..((.....))))))))).))))))))))))))....(((((((.....................((((.((...)).)))).,{{.(((((((((,....,,))))))))).,.......)))))))...,...)))).))))),..)))){(((((((.....(((((((({(((....)))....,,))))).)))...)))))))}.((((((({((.,,,.(((((((,{(,..((((((((..(((((((.(((.(((((.,(({{(((((.......)))))..,})}}....)))))))).)))))))..)))).........,.((((((((......)))))))}.,))))}}}}.))))))).....,,((((.......)))),.,.})}.)))))))......))))))).....,)}.}})))))))))))},.}}}|||||.,,|{{{{{{{{,(((({,,,,|}}}}..(((((((........)))))))..}}))))).}}))}}|,,,..,{|||.,,{(({{{{,.{|{|{({{|,,,,{||,..,|||||||||||||||,,...,((((({{...,,,,...,,..((((((((..{(({........))))..)))))))),,),)))))})}....,}}}}})},}}))))},..)))},||}}.,,,.,,{{{(({{{{{{{,{{,,},,,,,,))})}}|,{{||||}|||||},.}}))}},.,,,,}))}}}}))),,.,.}}}))})))}.,,},,,..........

Transcripts

ID Sequence Length GC content
AGACUCAACAAGAGCUCCAGCAAAGACUUUCACUGUAGCUUGACUUGAC… 1676 nt 0.3652
Summary

This gene encodes a member of the calcium dependent lectin superfamily of type II transmembrane receptors. Expression of the encoded protein is induced upon activation of T lymphocytes, and may play a role in proliferation. Furthermore, the protein may act to transmit signals in natural killer cells and platelets. [provided by RefSeq, Aug 2011]

Forensic Context

A study in mice demonstrated that the CD69 was significantly upregulated at 14 days post-injury in microglia isolated from brains after controlled cortical impact [Izzy et al. DOI:10.3389/fncel.2019.00307]. A study in porcine skin demonstrated that the CD69 was significantly decreased in response to both sulfur mustard and thermal burn injury at 7 days postexposure [Price et al. DOI:10.080/15569520903097754].