| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUCUGAGCUCUGAGCGCCUGCGGUCUCCUGUGUGCUGCUCUCUGUGG… | 1284 nt | 0.6667 |
This gene encodes a transmembrane protein which is a member of the immunoglobulin superfamily. This protein is found on thymocytes and mature T cells. It plays an essential role in T-cell interactions and also in T-cell/B-cell interaction during early lymphoid development. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the CD7 mRNA was significantly dysregulated in lung tissue 48 hours after 12 Gy thoracic irradiation and was functionally annotated to the hematopoietic cell lineage pathway, indicating its involvement in the early molecular response to radiation-induced lung injury [Li et al. DOI:10.1177/1559325819891012].