Basic Information

Symbol
CD93
RNA class
mRNA
Alias
CD93 Molecule C1qR(P) CDw93 CD93 Antigen DJ737E23.1 C1qRP ECSM3 C1QR1 MXRA4 Complement Component 1 Q Subcomponent Receptor 1 Matrix-Remodeling-Associated Protein 4 Complement Component C1q Receptor Matrix-Remodelling Associated 4 C1q/MBL/SPA Receptor C1qR Complement Component 1, Q Subcomponent, Receptor 1 C1q Receptor 1 C1qRp
Location (GRCh38)
20:23065139-23086324
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Tissue/body fluid identification Mechanical injury analysis Time since deposition estimation
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_012072.4
Sequence length
6681.0 nt
GC content
0.5094

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2405.90 kcal/mol
Thermodynamic ensemble
Free energy: -2530.43 kcal/mol
Frequency: 0.0000
Diversity: 1870.89
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(.((((((((((((((.....))).))))(((..(((((.((((((((((.(((((((((((((((..........))))))).....))))))).....(((((..((..(((((((..(((.((..((((((((((((...(((((((((..((.((....)).)).(((((((.(((.(((...))).))).)))))))...((((((((.(((((((((...((((...(((((......(((((.((((((((((((((((..(((((((((((..((....(((..((...((((((((..((((((((((.((.......(((((..((.((((.((.((....)))).)))).))..)))))(((((((((((((.(....((((((.(((.((((((((((((((....(((((((..((((.(((((..((((((...((((.(((((((((((((....))))))..))))))).))))..))).)))))))).))))..)).......))))))))))))))..))).)))))...))))))))))))).((.(((((.......))))).))..........)))))))..)))))))))..)))))))))))((((((....))))))..))..)))...))..))))))))...))).)))))))))((.((((........)))).)))))).)))))))))))))..((((.....))))..))))...)))))))))(((((((.((((.(((((..........(((..(.(((((..(((((.(((((.(..((((((...((......))...)))))).((((((.....))))))...(((((.....((....((((((((......((((((..((((((((((........)))))..))....)))..)))))))))).))))....))......)))))((((((((((((((...(((((((((.....))....))))))).(((((.(((((.((((((((((.((((...(((((....((((.(.((.(.((((.((((((((..(((.((((((((.((((((((.........(((((.(((((((((....)))))(((((((.((....))))))))).....)))))))))........((((((((.(((..((.((((((.((((....)))).)))))).)).(((((.......)).)))..((((...))))))).))))))))(((((((((((.((....((((..((.((((((((((((.(((.......))))))))))).)))))).))))...(((((((..((((.(((((...)))))..((((((((((((....(((.......)))...))))))))))))...)))).))))))).)).)))))))))))(((.(((((((.((.......((((..((.....))..)))).......)))))))))..))).((((((....)))))).......)))))))))))........))))))))......)))))))).)))).).)).)...))))......)))))(((((........)))))((....))..(((((....)))))..)))))))))....((((((((...........)))).)))).((.(((....)))))........(((((..........)))))((((...)))).))))).))))))))))))))))))))....))))....).))))))))))...))))))..)))))))).)))).)))))))))))))))(((((..........).))))......(((((.....))))).............))))).))))))))))))))))..))))).))))))).))...)))))...........).)))).)).))))...)))))..))).))))))).).(((((.(((((((..((((.((((((((..((((..(((((((((((((....((((((....(((((((((((.(((...((....((((.((((((((((((((.((((((((.((((.....)))).))))))(((..((((..(((((((.((((((.(((..((((((.(((((.....((......)).......(((..(((..((((.(((....)))))))..))))))......))))))))))).......(((.....)))))).)))))).))).)))).))))..)))((.((..(((.((((..((((((((....(((((((......))..))))))))))......((((...........(((.((..((((..(((((((((((((((((.((((((....)))))).........((((.(((((..(((...((((((((((((....(((.((((..((((.((....((((..(((((.....)))))...)))))).)))).))))..)))............((((((((......))))))))(((((((((...(((........(((.((..((((.....(((((((((((..........................))).))))))))...))))..))))))))....)))))))))..........)))))))))))).)))..))))))))).)))))))...((((((..((((......((((..((......)).))))......))))....))))))..((.((((..((((((((.(((((((((((((....(((.(((((....((((...........))))..)))))))))))))))))))))..............)))))))).)))).))))))).)))))...))))..)).)))...........)))).....(((((((((...))))))))))))..)))).))).)).))((((((((((((((((..(..((((((((.....((((((((((((((((((((.....(((((((((.......((((((.(((((....((((((((((((.(((((((((.(((.(..(((.(((.((((((((..(((.(((..........))).))).)))))))).))).)))..).))).))...)))))))...((((((.....)))))).((((((.....))).)))..)))))))).))))(((((...)))))..))))))))))))))))))))(((.((((((....)))))).)))((((((.(((.(((((((((((.((.(..((((.............((((.....))))........((((((............))))))..(((((((..((..............))..)))))))....))))..))))))))))))))))).))))))((((.................................))))...((((......)))))))))))))))....)))))).))).((((((((((.((((.((.(((...))).)))))).))))...(((((((.....)))))))((((........)))).........((((...(((((.(.....).)))))..))))..(((......)))(((((((..(((((((.(((((...)))..)).))))).))..)))))))))))))....))))))))..)..)))))))..)).)))))))....((((((((((.(((((......(((.((.(((((.((....((((((....))))))((((((((..((((((((((.(((((((..((((((((((....((((....))))...))))))))))..(((((.(((((((.((.((((((((((((........((..(((((...)))))..))(((.(((.....))).)))...((((.((......)).)))).(((....(((((.(((.((((.((((((..(((((((((((((..(((((((((((....(((((((((((....)))...)).))))))))))).))))))..)).)))))..............(((....))).((((((((((((((((((.......((((((((((........))))).)))))((((....))))(((((.(((((((((((((((((((...)))))..(((((((.((((.....((((((.....((((((((((((.....((((..(((.((..(((((.....)))))..)).)))..))))(((((((......)))))))..((((.(((((((((.(((((...)))))))))).(((.(((((........))))).))).........)))).))))..(((((.((((((((.((.((((((((((........))..))))..)))).)).)))))).)).)))))....(((((.((....)).))))).))).))).)))))).....)))))).....(((((((((.......((........))........))))))))).........)))).))))))).)))))))......(((((((......))))))).((((....))))...........((((.((.((((((((((....)))).)))))))).)).)).)))))))..))))))))).)))...)))))))))))..((((((...(((((........(((.((.((((.(((.((.....)).))))))))))))))))).....).)))))..(((((((.((((((.((((((((((((.........)))))....)))))))((((((.((.....)).))))))....((((((...((((......(((((....)))))..))))...))))))))))))..)))).)))......))))))........((((.....)))).....)))))))))))))))))))))...(((((...)))))((((.((.((((...(((((((((...........))))))))).)))))))).))(((((..((((...)))).)))))(((((((.......((((((..............(((..((.(((((((((.((((((((....)))).(((((((.(((((.(((((...((((((((((.........((((((((((((...(((((((((..((((((.((((((((((...((((..(((....)))......(((.((((......)))).)))....))))..))))))))))..)))))).....))))...)))))...))))..))))))))((.(((((.(...).))))).))(((((....))))).))))))))))...))))))).))).)))))))(((((((((..(..(((((((.........)))......(((((((...((((((...(((....((.((((......)))).))..)))...)).))))....))))))).(((((...)))))..((((.......))))))))..)..)))))).))).(((((((..(((..(((...((((((.((.(......).)))))))).)))..)))))))))))))).))))))))).))..)))............)))))).....)))))))))))))).))))).)))))))))..)))))...(((((.((((..(((....)))..)))).)))))...................))))))).))))))))))(((.(((((((.(((((((((...(((((..((((((((((((((((....))).........((((....(((.......)))....))))....((((((((...(((((((((((((((((.((.(((((...((((.....)))).......(((((.(((((((((.((((.......))))..))))).))))...((((...........)))).......)))))..................................))))))))))))))))))...........))))))...))))))))........))))))))..))))))))))))))))))).(((........))).)))))))..))).)))))))).)).))))).)))))......)))))))))))).)))))))))))))))..))))))))....))..))).))))..))))))).....((((((((....)).))))))....))))))...))))))))))).))..))))..))))))))...))))((((..(((.....(((((((..((....))...)))))))......)))..))))(((((....)))))...))))))).................(((((((........)))))))....)))))...((((..(((((((...(((((.......))))))))))))..))))...........(((.(((((((((......(((((((((((((((((...........)))).........))))))).))))))...)))))))))))).
Thermodynamic Ensemble Prediction
(((((((((((((((((,...,))).))))(((..(((((.(((((((((({(((((((({((((({{{,{...,.,||}||,||....)),)))))}}},|{|||,,|{..(((((((..(((.((..(((((((((({,.,{(((((((((,.((.{{.,,.)).}}.(((((((.(((.(((...))).))).)))))))...{{.(((((.(((((((((.{.((((...(((((......(((((.(((((({(((((((((,,,((((((((((..{{....(((..((.,.((((((((..{({(((((((.,{..,.{{.(((((..((.((((.((.({....}})}.)))).))..))))){,{||((((((({{(....((((((.(((.({(({(((((((((....(((((((..((((.(((((..((((((...((((.(((((((((((((....))))))..))))))).))))..))).)))))))).))))..))}}.....}}))))))))))))..))).)))))...))))))},},,,,.||.(((((.......))))).)),.,,,,,,.})}))))),.},)))))))..}}}))))))))((((((....))))))..))..))}...}}..)))))))).},)),.))))))))){{.{(((....,,,,|||}.}))))).)))))))))))))..((((.....))))..))))..,))))))))).,..))))).||{{((((.((((({{{((((((.((((({,(((((((({{{(((,{{((({{.,,({,,.,,{|}.,||||||,.{||||{..,,.}}|||,..((((((((.....)))...)))))..}}|((((((((((({((.(((((((,,{{.((,...,,,,,},,.,....))))))).)}|((((((((((....{((((((({....))))))))}}.{((({(({{(((((,,{((((({.,|||||,,.}}}|||.....|.,,,.,.....||||,,|||||}}}|||(({{{{{,{(((({(({{{{{,|.{(((({(..||}},,)))........|||||}{{|||{|||,,,,}|||,(((((({{{(....))))))))),,,.}}}})))))),.....,,|||||.},}}}))}|{}{(((((.((((....)))).))))))|}},.,,)))),)),}.},)))))|||....)))))))))))))))})))))))))))|{{{,..((((..((.((((((((((((.(((.......))))))))))).)))))).)))),,||||||.,,{{{{...,,,.}}}))},))))))))},,}))))).))))).)))}..(((((((((...(((.......((((((({((((((((({(((,((((((((..((((((........)))))).))}....,.(((((((.((((...)))){(((((((((((((....|||||{{.((({{.{{(((((((,{({(((((,{,.({.,{{((.{{{.,,}||}}}}.}}.)}.}...}}}},....,..{||.{||}.,,)))))}}|,||}},,))},.|||||,,..}))))|,,}.||||.,,}},{(((((((...........)))).)))).|{.(((....))))),},,....,,,,|||,|,.{{{.|{|{|{{||||||,.,,))),},||,))))}))}),))).)}))))))))))....)))))))..{{.{((((...))))).)),.))))).)))).)}))}))).))))))))).....))).))))))))).))))}..}))),)}..............})))).))))))))))))))))..))))).))))))),)),,,})))),...}},,,..,.)))).)).))))...)))))..))).))))))}...,,{{{.(((((((,.((((.((((((((..((((..(((((((((((((....((((((...,(((((((((((.(((...{{....((((.((((((((((((({.,,((((((.((((.....)))).)))))).{(({((,{.{({{((,(((((.,.((((({(((({{{(((((..,{,..,{{,...,,}},..,||,..(((..(((,,(({....}))))))..))),}}......)))))))))|{{{{{{((,(,{(,{(({((((.,,.....,,.}}}}.}},})}},)}}||}}||,,,(((((((({.(((((....((((({{......}}..)))))))))),{{{{{,......,,{,....((((({(..((((((({(((((({,({(((,,((((((.,,,|}}}})}||,,|||||||{,{,((((((((,,.((.,,...,.))...}))))))).,{{,.,|{((({(,{((({{(,.(((((((((({((,{{..,})).)}}}}},}))))}.}}},}},,}}}}})}}||,,},.)))}))),...}}})))}.}}))),.,|||,,{{{,{({{.....||||{{,((((((((({..........,(((((.{{.(({((,|....,||,|.....,},|}|{((((..(((((((((((((((....((((((({(((((((((((((((((.....)))))))))..{(((((.,((({.....,((((,.({.....,}).})))..,,,.}},},,}.)))))}..))))))))}((((((((.(((((((((((((....{({.(((((....((((...........))))..)))))))))))))))))))))..............})))))))))))))).....))))}....{{{{{{{{|.{{..{{{...{{{({{{......(((((((({...}))))))))((((((((((({{{......(((((((((((((((..(..((((((({..,,,(({(((((((((((((((({.....(((((((((,......{({(((((((((....((((((((((((.(((((((((.(((.(..(((.(((.((((((({.,((({(((..........))).)))})))))))).))).)))..).))).}},,.}))))))..,(((,,,.,,,.||,,||{(({{,,.,.}}))),}}...)))))))).))))(((({...)))))..))))))))))))))))))))(((.((((((....)))))).)))((((((.(({((((((((((((.((.(..((((........,,,..((((.....))))...,,...{({{{(.,........,.}}}}}}.|{((((((..({.............,))..)))))))....))))..)))))))))))))))}),))))))||{{.................................))),...((((......))))}))))))))))....)))))).}||{(((,{{((((.((((.((.(((...))).)))))).))))...(((((((.....}}}}}}|((((.,,,,...}|||....,,,..((((...(((((.(.....).)))))..))))..|||,,,...|{((((((((..{((((({.{{(({...}})..)).))})),))..))))))))))},}....))))))))..)..))))))),.||{{|(((({....})})}}))|,,.((((((.(((((...))))).)))))),,((((((....})))))....,|))|}))}|{.{(((...,{{((,.((((((((((....((((....))))...})))))))))})))....))}},}}..,{{((((|||||||.,,,}}}}|,..{((({...))))}..}}))})}}..})))).)))))...)))).....}))))))|{{{{,{({{{{({(|(..,,.,...},))|}|.})}}}))))}))),.)|,|||,})))))})))))))))).))))},,,..}}))},))))))),}}.|,{(((({......)))))}........}}))}}}}}),,.{{{{(({((({{{{|{{{..,....((((((((((........))))).)))))((({....)))),,{||||||||||,|}},,,{{(({..{||||,..|{{....{({,{{....)},}))....,}}.,}}|||.,..,}}.{(((..(((.((..(((((.....)))))..)).)))..))),(((((((......))))))).|||}},}}}}|{{{{.(((((...)))))})))),|||,||{{{...,,,,,)))))}))),.,....,,..(((.(((((((((((((((((...(((((((({((((........))))}}}.(((((.({...))))))){,||}}||.,{{..{(((({((((((({{{,{.{{{...}}).,,))}.})))))}....,.(((((((((.......((........))........)))))))))........}))))))|||{{...{{|||....,..(((((((......))))))).((((....))))...........))))).)))),)))))))))))))))))).)))})))))}),)))))))..,))))),)).,)).,}))))||||}||{....((({{{((((........,{{,,{{.{{{{.|{|,||,,.,,||.}}))))||,{{{|||||.{{{{,,,||||{,{{(((((.((((((.{{{{((((((((.,.....,.)))))....)))|||,{(((((.((.....)).)))))}.,,,((((((...((((......(((({....}))))..))))...)))))))))))},.)))).,|{((({{{((({{{..,|,...((((.....))))..|||,,,,{{{||{{||||{|,......(((((...))))),{((.((.((((,,,((((((((({..........))))))))).)))))))).},(((((..((((...)))).)))))|,,,......,,}||||||,.,||,...{{{{{.{{{.,.|,{{{||||||}|{{((({.,,,|||||,(((((((.(((((.(((((...((((((((((.........((((((((((((...(((((((((..((((((.((((((((((.,.((((..(((....))}....,.(((.((((......)))).)))....))))..))))))))))..)))))).....))))...)))))...)))}..)))))))){{.(((((,(....}))))).})(((((....))))).)))))))))).,.)))))))},)).))))))}{{((,.{|||||.{{{{{{|||,,.{{{{{|||..|||||{(((.,...,|||...,||{|||..,,.{{{(......}))}...,})))}}},,..}))).})))}}||}}||,|},|||},,,{{(({,...,,,,}}))},}},.},))),))))),..,,,.,,,.....((((((((((...(((((((.......{{((((.((..(((((.(((((((((((.....{(((,,,....||....,||,...(((((((.....((((((.....{{..(((((({.((((.((((..({,...{((({.((((..(((....}}}..)))).))))).........{(((((({...})))))))})..)))).)))).}.))))))...}}......)))))).)))))))....(((((.......)))))......|||.....))).},,,..)))))))))).).)))))..)).)))),}}(((((((((((,{(.(((((...{(({.....)))),,,....,,,{{.{((((((((.((((.......)}))..))))).)))},,.((((...........)))),||,...,,|||,.........},}}..........,.........))))))))))))))))))....)))))))...))))))))))....,,,,,...,,)))})),))))))),)}),)))}.,,|,,{((((((,...}))))))),,})))...}}}}...}}}}.}}}}|)},.......)))}))))))}.},,.,))))))))))))..))))))))....}}..))).))))..))))))}.,...(((({(((....))},))}))....))))))...))))))))))).))..))))..))))))))...)))){(((..(((.....(((((((..{(....}}...)))))))......)))..)))}(((({....}))))...))))))),,,,....|,,,,,,..(((((((........)))))))|{{||{{{....{{((..(((((({..,(((((.......))))))))))))..)))}.........,}}|}}|{(((((((......((((((((((((((({{.,.........}))).........})))))).))))))...)))))))})))).

Transcripts

ID Sequence Length GC content
NM_012072.4 NCBI
GUGUCCUUCUCUGCGCCGGAGUGGCUGCAGCUCACCCCUCAGCUCCCCU… 6681 nt 0.5094
Summary

The protein encoded by this gene is a cell-surface glycoprotein and type I membrane protein that was originally identified as a myeloid cell-specific marker. The encoded protein was once thought to be a receptor for C1q, but now is thought to instead be involved in intercellular adhesion and in the clearance of apoptotic cells. The intracellular cytoplasmic tail of this protein has been found to interact with moesin, a protein known to play a role in linking transmembrane proteins to the cytoskeleton and in the remodelling of the cytoskeleton. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the CD93 transcript, a marker for cell adhesion, was upregulated 3.0-fold in the injured ipsilateral neocortex three days after a closed head injury, indicating its involvement in the inflammatory response to mild traumatic brain injury [Israelsson et al. DOI:10.1089/neu.2008.0676]. In human forensic genetics, the CD93 gene was identified as a candidate mRNA biomarker for body fluid identification, being expressed in blood and detectable via whole transcriptome shotgun sequencing from low template samples [Jepsen et al. DOI:10.1016/j.fsigen.2024.103089]. A study in humans demonstrated that the CD93 is a stable mRNA marker for blood identification, showing a blood-specific expression pattern with no detectable amplification in semen and remaining detectable in stains aged up to 180 days [Zubakov et al. DOI:10.1007/s00414-007-0182-6]. Subsequent research confirmed its stability and reliability in much older forensic samples, as the CD93 was successfully amplified from 13–16-year-old blood stains with 100% reproducibility between individuals from large stains and remained detectable in small stains [Zubakov et al. DOI:10.1007/s00414-008-0249-z].