| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGCUGCUGGAGCGCUCGGGGUCCCCGGGCGGCGGCGGCGGCGCAGAG… | 1418 nt | 0.6509 |
The protein encoded by this gene is a member of the ubiquitin-conjugating enzyme family. Ubiquitin-conjugating enzyme catalyzes the covalent attachment of ubiquitin to other proteins. This protein is a part of the large multiprotein complex, which is required for ubiquitin-mediated degradation of cell cycle G1 regulators, and for the initiation of DNA replication. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that chronic methamphetamine administration significantly dysregulated the CDC34 in microglial cells, as part of a broad disruption of the ubiquitin-mediated proteolysis pathway revealed by single-cell RNA sequencing [Oladapo et al. DOI:10.3390/Ijms26020649].