Basic Information

Symbol
ACVR2B
RNA class
mRNA
Alias
Activin A Receptor Type 2B ActR-IIB Activin A Receptor, Type IIB Activin Receptor Type-2B EC 2.7.11.30 Activin Receptor Type IIB EC 2.7.11 ACTR-IIB ACTRIIB HTX4
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_001106.4
Sequence length
11782.0 nt
GC content
0.4563

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3835.40 kcal/mol
Thermodynamic ensemble
Free energy: -4059.25 kcal/mol
Frequency: 0.0000
Diversity: 2581.03
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.((...((((((((((((((((.(((((((...((((((..(((((..((((((((((....((((.(((((((......(((.(((.((((..((((((((.(((((((.((((.(((..((((.(((....((....(.(((((((((((.((((((.((..(((.(..(((....)))..).)))..))..))).))).))).))).))))))...)).))).))))..))).)))))))))))....((.((((((.(..(((((.......)))))..).)))).)).))....))))))))..)))).))).)))...)))))))..)))).(((((((.(((((((.((((((((((((((((.(((.(((((.(((...)))))))))))))))).)))))))))))(((((((((.....)).)))))))..)))))))..((.(((......)))))..)))))))..((((((.(((((..(((.(((((((..(((((..((.(.((((((((((((.....(((((((.((((((((...(((((((....((..((((((.((.(((((((((..((......))..))))).)))))).))))))..)))))))))........(((((........)))))((((((..((((.......(((((......)))))(((.(((((((((((((((((((.....(((((.(((((.(((((.((((((((..(((((.(((((((.((...........))(((.((.(((((((.(((..((..(......)..))..)))...)))))))))))).....((((((((((..(((......((((...((((((((...((((((.((((.(((((((.(((((((((....))))).)))).........))))).))))))....)))))).....)))))))).((((((.......))))))......(((((..((.(((.((.(((.......))).)))))))..))))).(((((((((((((..(((((((........(((.((((..(((((((((((((((((.(((.....))).)))...))))...))))))))))))))))).....)))).)))..........((((((((((...(((.......)))((((......))))......)))))))))).......))))))))).)))).))))(((.....)))...((((((((((....(((((.(((((..((..(((((((.(((((((((.(((((.(((((..(((((((((..(((((((..(((((((...(((.(((((((((.(((.....))).))....).)))).)).))).....(((((.......)))))...((((.((((((.(((((((...((((.(((..(((((.(((((((...((..((..(((....)))..))..))....))))))).)))))..))).)))).)))))))..)))))))))).((((((.((((..(((...))).)))).)))))))))))))..)))))).)..))))))..)))..))))).)..)))).))).)))))).))).)))).))...))))))))))..........))))))))))..)))...)))))))))).))))))).))))).(((((((((.((((((.((((.((((.((((((((.........((((...)))).........))))))....)).)))).))))))))))(((((((((((.((((........((.((((((((.((((((.....)))))).)))))))).))(((.......)))..))))..))))))).))))((((((((((.......(((((((....))))))).(((((.(((((((((....(((((..((......))...((((((((((.(((((((.((((((((((((.((((((...((((((((..(((((((((((((((((..................))))...)))))))))))))....)))).))))...)))))).(((((.((..(((((((...)))))))...)).))))).......((((..(((((((.(((((..((((((..((((...(((((((.(..(((((((.(((.(((((....))))).)))))..)))))))))))))....))))..)))))).....((((((((((...........(((((........))))).......(((.(((((.(((.(((...))).)))))))).))).((((((((((.((((((...)))))((.(.(((((((((((((((((((...........((((.......))))....((((((....)))))).))))))))(((..((((.(((((((((.((...((((.(((...((.....((((((((((((..(((........)))((((.(((.....))).))))..((((......))))............))))))))))))..))...)))..))))..)).))))))))).))))..)))))))))))))).).))((((((...))).)))((..((....((((.(((.(((........))).))).))))....))..))......((((((((((((...(((((((...(((((((.((.((.(((((((((((((((((((((((......(((((((((((((((((.....(((((((.(.((((((..........))).))).)..)))).)))(((((........(((((((((.((((.......)))).))))))))))))))..)))))))).......((((...))))......)))))....))))......(((.((((((......)))))))))(((((((((.(((.(((...))).)))))).)))))).(((((..((((((..(((....(((....)))((((((.((((....))))))))))((((((((...((((((........)))))).....))))).)))..((((....)))))))..))))))......))))))))))))))))))))))).....((((..((((....(((((....)))))....))))))))......))))).))..)).)))))))........(((((((((....(((((.....)))))....))))))).))..((((((((((((((((..((((........(((((((..............)))))))........))))....)))))))...)))))))))....)))))))(((((((..((..((((((((.....((..((.((((..(....(((((((......)))))))....)..)))).))..))(((((...((((..((((......))))..)))).....))))).....((((((((((.((((((((((((((((((((((.((((((((.(..((((......((((((.....((((((((................((((((...)))))).(((((((((...))))))))).......((((((((...(((((.....)))))((((((....))))))................(((.((((........)))))))))))))))))))).)))..(((((((((((((((((((((((((.((((((......)))))).))))............((((((.((......)).)))))).(((((.(((.((........)).)))))))).((((((.(((.....(((..((((.....))))..)))))).))))))...))))))))))..))))))))))))))))).....)))).).)))))))).....((((((((.(((((...((((((..((((((((((((((((((((.(((...))))))))))..((((((...))))))))))))))..)))))(((...)))..((((((((.(((((((((((......)))))...)).)))).))))))))(((((.....)))))((((......))))..)))).))...)))))))))))))(((((((......)))))))...((((((((.(((((((..((((.(((((..........)))))..))))...))))))).)))))))))))))))...........))))))))))))))).))))))))))))))))))...))..)))))))...))))))))))))..(((((((...((((((....(((((((((((.....(((((((..((...(((((((((...)))))...)))).....))..)))))))((.....((((.....)))).....))...(((((.(((((((................(.(((((((((.....(((((((...(((((........)))))......)))).))).....(((((((((..((((((.((.(((......))).)).))))))...)).))))))).))))))))).)..((((((((..(((.(((....((((((((((((((((.......))).)))).((((((.....))))))....)))))))))....))))))))))))))))))))))))))........((((((((.......))).)))))..(((((..........)))))..))))))))))))))))).)))))))..).)))))))))).(((.....))))))))))))))))))..)))))))..)))).(((((..(((((((((((.....(((((.(((....((((((...))))))))).))).))......))).))))).)))..)))))((((((.....(((((((.(((((((..(.(.((.((.((((((((((..((((((...)))))).)))))))))))).))).)..))))))).)))))))....)))))).((((...))))...))))))))))))...((((((..(((.((((.......((((.((....))))))....))))....))))))))).(((..((((((.(((((((((((((.((((..(((((((....(((.(((((((((((.((...)).)))))))))))))).((((((.......)))))))))))))..))))....))))..))))))))).))))))..)))(((((((((((((((......((((.((((((..((((.(....).))))..))))))...(((((((.((..((((((......((....))......)))))))).)))))))(((((....))))).....)))))))))))))))))))...))))))).))...((((((.(((.((((..(((..(((((((((((......))))))))..((((((....))))))..(((......)))(((((((....)))))))..(((((.((.(..(((((((((..(((((..((((((.((.((((....(((((((....)))(((((.((((((((((.(((...........)))(((((((((((..((((((....))))))..))))))))))).)))))))))).)))))))))...)))))).)))))).))))))))))))))..).)).)))))(((....)))......)))..)))....)))).))))))))))))))))).))))))))))...(((((.(((.....(((((((.....))))))).....))).)))))((((((((((((((.((....((....)).....)).)))))))))).)))).)))))))))))))))))))..((...(((......)))..)).....))))))).))................)).))))))...))))).)))....))))))))))))))))).))))))))).)))........))))..)))).))...)))))))).))))..((.((((.(((((.((....)).))))).))))))..............)))....)))))))).)))).))).....)))))..)))))))))).))))).))))))...))).))))))).)))))..))..........))))...)))))))))((((((((((((....(((((.((((((((((.((((.........(((((((((.(((......))))))..))))))..(((((((...((((.............))))...)))))))))))))))))))))..)).)))))))))....))))))......((((....)))).....(((..(((((((....))))))).)))..((((((((..((((((((.....(((.......((((..((((((((((((((((.(((((.(...((((((.....(((((((((......)))).))))).....(((((((((((((((((.(((..(((((((.(((((.((.((((((((((.....))).....((((((((((.((((...)))).))))))))))....(((((((.(((((((..........((((((((......(((.........)))......))))))))((((...((((((((...(((((((.......))))...((((....))))..(((((.((((...((.((((...)))).))..)))).)))))..)))..))))).)))...)))).....))))))).(((((...((((...((((.....)))).........((((.....))))(((((((((((...((((((.....((((((((.(((.((((((....(((((((........((.((((((((..(((..........)))..)))))))).))(((.(((((((..........(((((((.(((((((((......)))).)))))....((((.((((..(((....))).)))).))))...)))))))........))))))).)))(((((((((((((((((......))))))).....(((..(((((((((..((((.................))))..)))))))))..))).(((((((.......))).))))..(((.((((((((((.((((((((...(((..(((...........((((((..(((((.(((((......))))).)))))..))))))...((((((((.....)))..((((((((..(.....)..))))))))((..((((((((((((((((((.........)))))))))((((.(((((((((((...))))))))))).))))((....))..........)))))).)))..))...((((((((........)))))))))))))(((((.....))))).)))..))).)))....)))))..)))))))))).)))....)))))))))).....((((((((((.((...........((((.(((((.((((((((..(.(.((((((((..(((.(((....))).))).)))))))).).)))))))))...)).))).)))))).))))))))))....(((((.(..............).)))))((((....)))).((((..((((..((((((((((.....)))))....)))))...))))..)))).)))))))....((((((((((........((((.......))))(((.....))).(((((.((((((...((((((((((((.........(((((((((((...........)))))))))))...(((((....)))))(((.((((....)))).))).............)))))))))))).......(((((((((((........))))).))))))(((((.((....)).))))).((((......))))....)))))))))))..))))))))))..........((((((((((..(((((.((((((((((.(((.(((...((((((...))))))))).))).)))))..(((..(((((.((((..((((.(((((((....((((.((((.(((((....))((((.(((...))).))))((((.(((..(((((..(((((...(((((.(((..((.((((((((((..((((...((..(((((..((((((((...(((......)))..((((((((..........))))))))..(((((((((((((.(((........(((((((((((((((((((........)))))(((((......(((((((((((((.(((((...(((((..((((......))))..)))))....))))).......((((........))))..((((((.((((...((((((...((((((...(((.((((((((((((.((((....(((((((...(((.(((....((((((((...)))).))))....)))...)))...)))))))....))))..((((((.((.......))..)))))).((((((((.(((((........)))))..))))))))............)))).))))))))...)))....(((((((((..((((......(((((.........(((.((.(((((((((.(((.(.((..(((.....)))...))..).)))))))))))))))))((((((....))))))((((.....(((((..((((...))))..)))))....))))........)))))....)))).)))))))))..(((.(((.(((......))).))).)))...........((((((.......))))))))))))..))))))...))))...))))))))))))..))))))).....))))).....))))))))))))))..))))))))))...))))))..))))))))..)))))..))..)))))))))))))).))..))).)))))...................)))))..))))))))))))........................(((.(((((((.(((....)))))))))).)))))).)))).)))))))))))))))..)))).))))).)))((((((((.(((((...((((((((((((.....((((...((.(((((...))))))).))))......(((((....)))))...((((((((((.......((..((((((.....)))))).))...(((((((((((((.(((((.((((......))))...((.((.......)).))..(((..((((((((((((..((.....((((((((..((.(((.(((..........))).))).))..))))))))....(((.((((((.....)))))).)))............((....))...(((((...))))).))..))))))))))))..))))))))...)))))))))))))..)))))))))).))))))))((.(((((((((...((((((((.((((((.....((((.((((........((((((((.....))))))))........)))).)))).......)))...)))...))))))))...)))))......)))).))......))))...))))).))))))))..((((..........))))..)))))))))).)))).))))))(((((((((((((..(((...(((((((.(..((((......))))..))))))))...)))..))......))))).))))))......)))))).))).))).)))))..........)))))))))))))))))((((.(.((...(((.((((((((((((.....))))).....))))))))))...)).).))))))))...)))))......((((.((....))))))......)))))))..................))).)))))).)))))...)))))))...)))..))))))...))))))))).))....)))))).).)))))((.....)).....))).)))))))))))))..)))).))).....)))))))).....)))))..)))((((((((((((((((........)))))..))))))))))).(((((((((((.((......)).))))))))))).)))))))).(((((....))))).....)))))).)).)))).((((((...((((((((((...((((..((((((...(((.........((((((.((((((((((....(((((((........(((((.(((.....))).)))))..((((((.........(((((.(((...........(((((((((....(((.....(((((..(.(((.(((.........((((((..((...(((.(...(((....))).).)))...))..)))))).)))))))..)))))....)))..)))))))))))).))))).(((.(((((.......)))))..)))..((((((.....((..((((((.(((.....(((.((((..((...))..)))).))).....))).))))))))..))))))....(((((((..........))))).))...((((((((((.((((((((.........))))))))..((((((((((..(((((((((...(((((...))))).....))).)))))).))).(((((((.(((((((.((((.((((.((.(((((...........))))).)).).))).)))).)))))))))))))).(((((.(((((..(((......))))))))))))).......)))))))....((((.....)))).....((((((((..((((((((.(((((...(((((((((.........(((((((((....)))))))))(((((.(((((((((.(((.(((...((((....)))).......((((.((((((.....)))))))))).......))))))))))).)))).)))))..((.....))...)))))))))))))))))))))).))))))))................................................................))))))))))..........)))))).)))))))......)))....))))))).)))))).........)))(((((.(((((((................)))))))..)))))............))))))(((((((((..(((...)))..)))))))))...........((((((((...(((((((....((.((((.(((.....((((.................)))).....))).))))))..)))))))...))))))))....))))...)))))))))).))))))..(((((((..((((((........)))))).....)))))))..
Thermodynamic Ensemble Prediction
.((({((((((,{(((....))|,.))))))....,((.,.((((|,.((((,{,({{{,.{,....,,,,.,(({,,...}}..(((.(((.((((..((((((((.(((((({(((((.(((..((((.(((....((..,.(.(((((((((((.((((((.((..(((.(,,({{...,)))..,.)))..))..))).))).))),})).)))))),}.)}.))).))))..))).))))))))))).,..((.((((((.(..(((((.......)))))..).)))).)).))..}.))))))))..)))).))).)))..)),).))),,)).)))),.})))),.,))..(((((((((((((({(((((.(((((.(((...)))))))))))))))).)))))))))))(((((((((.....)).))))))),((((((((((((.(((((.(((((((((((((((((.((((((((.((.(((..(.({..((..(((....)))..))..)).)..))),..)).)))))))).))))}....(((((((....((..((((((.(,{(((((((((..((......))..))))).)))))).))))))..))))))))).......{,,...|.(((((((((((((((((....((((.......(((.((((.(((((.((((.(((((((..,(((((.((({...)),}}.))))}((.(((((((.{(({.,{{{{{{{,.{|..,,.........}))}}}}|||.(((((((.(((..((..{......)..))..)))...))))))).)))}})))))))))))))).)).)))).))))).))))..)))(((((((((..........(((((((((,((((....((((((....(((((.(((((....)))))(((((((.(((((((((.(((((((((..((.((((((({((({.((((((.,(({.((,(((({(((((({(,..{{{{{((((({,((,,.....(((((((((((((..(((((((........(((.((((..(((((((((((((((((.(((.....))).))}..,))))...))))))))))))))))).....)))),,))..,.{,....((((((((((..{(((..,,,,.,||({{{......})))).)))}))))))))))...}}..))))))))).))))))}))}))),,..,,....((((((((((..{,(((((.(((((..((..(((((((.((((((.((((({...,({({,{((({(((((,,{((((((.,({((({(,,,{({,{,((((({{.{||},,..}}}{||,..,||{|,},}),}}|.....(((((.......)))))...((((,{(((((.(((((((..,{(((.(((,{(((((.(((((((...{{..{{,.({{....})).,))..}}.,,.))))))).))))).,))).)))).))))))}..}))))))))).{{||{|,|{{(..(({,.,,||.}}}},}}}}}|}}||||}..}}}}}),}|,},}))}..))),,)})))})},))))))))))))))).))).)))).))...)))))))))).....,,.,.)))))))))),{((((,.(({{(((..(((((...))))).))))((((((((((((((,((((,(,,{.{,{(((({,||,.....,,,,..|||||.......,.)))}}}.}..,,.}})}})))})))..((((((((((((.((((.{((..({((.((((((((.((((((.....)))))).)))))))).)),|})..))}..,}}.))))..))))))).))))){((((||{{{..(((.(((((((....)))))))..,.((......,,,,(((((((((((({......||...(((((.{{...}}}}}}}.,.,((((.....)))}.,....,,{{,,,,..((((((((((((({{(((.....,.,.....},,,},}}...,||)))))))))),,..)))).,)))))))))))}.,{{{{.,{..(((({{{..,}}}}}}|,}.,}.))))).........))).,})}.))))},,,..((((((..((((...(((((((.(,.{((((,{.(((.(((((....))))).)))}}..)))))))))))))....))))..))))))..}},,....))))))))))),.....((((........))))))).})))}|(.(((((.(((.(((...))).)))))))).),.,}.}}})}}.{{.(((((...))))).}}(.(((((((((((((((((((.,,....,,..((((.,....}))))....|{((((....)))))}.))))))))(((..((((.(((((((((.((...((((.(((...((,((({(((((((((,((,,{,,.,{{{.{{|,,.,,|}|,|}}}}}))},|||,..((((......)))),,.......,}})),)))))))))..))...)))..))))..)).))))))))).))))..)))))))))))))).}.})))))).}}.))).})))))).},,..((((.(((.(((........))).))).)))),|.||,.}))},.....))))))).)).....)))))))))(((((((.((.((.(((((((((((((((((((((((,,,,,,(((({{{((({{(,{,..,,,{{{|{{{{.,.||||||.....,,.,,|||||||{{..}))).,,}(((((........(((((((((.((((.......)))).)))))))))))))).))))))))),,.....{{{{...,})},,,{{.|||}}....,,||.....}|(({((((((......))))))))}(((((((((.(((.{((...))}.)))))).)))))}{((((({({,{,,,.,|||}}.,(((....))){(((((.((((....)))))))))}|.((((((...((((((........)))))).....)))))),,|{.((({....})))})),.}}}}})},,}},)}}},)))))))))))))))))).....(((((,.{{(....((((,....})))}..,.}}))))))......))))).))..)).}))))))........(((((((((....(((((.....)))))....))))))).))..((((((((((((((((..((((........(((((((............,.)))))))........))))....)))))))),.,))))))))....(((((((((((((((((...,,.....,{{,,..,..,,.,{{|,,||{,,((({(((,,....}}|||}}....,..)}}),))..}}}}||,.,}}}}},..(((((((((..((((...(((((.,..{(((((({,{{,............{{{.(((({.{,..(((.((({...)))))))...,.))))).}}}.....,...(((..(((((.....((((((.....((((((((((((((..(((((((.{((((......,,((((({{{{,.({{((,,..,|||}}{{((({.,{{{{{|,.....}}}}}},..,..{((..,(((((,...,))))).,,)))||||||||}|||.|||||||||||..|,|,|||||,{|||.|(((((......))))))|)|||,||,,.,|,,,,((((((.,,..,}}})).}}}}}}.(((((.{({.{{.,......)).)))))))).,)))}))))}.)))))))....))))))))....)))))).....)))))))))))..))).,}})))))))),.)))))....)))).))))))))}..)))))))))....)).))))))(((((.((((((((((((((((((((((.(({...})))))))))..((((((...))))))))))))))..))))},)).)))))..((((((((.(((((((((((......)))))...)).)))).))))))))(((((.....)))))))))))))}.....))))))).)))))....))))))..(((((((......)))))))..{((((((((.(((((((..((((.(((((..........)))))..))))...))))))).))))))))}.{(((((((((((((..((((((((,(((({{(((({{,,...((((..(((((.((((((((......((((((((((({{..{({{.,,..((((.((((({((((((({((((,((((,{{{{{...........,....}))))(((((((((({.........,((((((....{{{{.....}}}|,....},...(((((.(((((((............,...,.(((((((({.....(((((((...(((((........)))))......))))}})).....(((((((((..((((((.((.(((......))).)).))))))...}}.))))))).))))))))).),,((((((((..((,{(((....((((((((({((((((.......))).)))}.((((((.....))))))....)))))))))....))))))))))))))))))))))))))........((((((((.......)))))}))).((((((((((({(,,,((.{{{{|,,,)))))}},((((((.,.(((.,.,,|||,,}}}}}}(((.....||||}}|}|(((((((((,{{((((...((({{....,},)))....))))))))))))))....,{(({(((((,,{{,|,|||{|..{(((((({...((((((((..,(({{{((((((((((((((..(((((((.(((((((,.(.,,((.((.((((((((((..((((((...)))))).)))))))))))).))).).,))))))).))))))){((.{{{,|||((((...))}}.}}......}||,}}|,((((({.......).)))))...,|,.,,..(((((((((((((((..((..((((((((({({({,,,,,,.........{((((((((((((((((((,(({{{(({.(((((((((({.((...)).}))))))))))}||.,,(((({({({,,{{((({(((((((((((((((((..........((((((.(((((,({{{(((((((((((((((,,....{(((.{(((((..((((.(....).))))..)))))),}.{((((((.((..((((((......({....})......)))))))).))))))}{((((....))))}.....})))))))))))))))))).|}.(((((((.(((....((((((((((((...((((((.(((,..,..(((((((.((((((.((((((....)))))).||(((({((({{((((((((({..(.(((((,(((((({(({,..(((((((({..(((((..((((((.((.((((....(((((((..,,}}}(((((.((((((((((.(((.........,.)))((((({(((((..((((((....))))))..)))))}))))),)))))))))).))))))))).,.)))))).)))))).))))))))))))))..,.)),}))))))}...})))},..))))))))},,||||||{..(({.....}}}.))}.||,((((((((((((({{{.{{{.....(((((((.....))))))),,,,,))),))))}|,,,((((((((((.((....,,....,}.....)).)))))))))),))))))))))).,}).))).))))))))).)))))))..},,..,))....)))))))))))...........{{...),........)))))))))).)))))))..,......,},..)))))...)))))))))))))))))))))).,,(({..,{{{{{,{,{||{{{|||{((({,,,,{}||,.,,))}}|}|}}))){((((,(({.{(((((((,((((.(((((((((((((((((((..((..(((....)))....))..)))))))),.((((((((((({.(((((((((.....,{((((((((...({.((((((((((.(({((((((.(((((....(({{((.(((.((((,,,{,,,(((((((((.(((......))))))..))))))...,,.,,...)))).))).)).})))...))))).))))))((((((.(((.((((((((((.,..((((({{((.(,(({,,...||||..,{|,........}},.,{{|||{..,,)))))})))).})))),.)))))))))).))).))))))......(((.(((({....}))))))).....})).)))))..)))))..),..))))))))}|{{(((((.((.................)).))))).})}...,{{,,,,}},(((........))).))))))))}....((((((((((.((((...)))).))))))))))..{((((({{({(,,{{{{...{{{....,,((((,({{{{{{((,..{{{{{.,|||.{{{{{|||||||{((((...((((((((...((({(((.......)))}...((({....}}}|..{{{{{.|{{(...{,.,,,,.,,}})}.,),.)))).)))))..)))..))))))}})...))))},,,,}|}}},,{{{,|{{{..|||||}||||}}}}}),,,}}..}..}}||}|}}}}}}}}.}))),})},},}})}),}))))})))}....{({,(((((((......))))))),}).....((.((((((((..(((..........)))..)))))))).))|((.(((((((,{({{.....{((((({.{((((((((......)))).))))}....,{{{.((((..{{,....,}}.)))).)))}...))))))))}},,,..})))))).))|(((((((((((((((((......))))))).....(((..(((((((((..((((,,..,.........,,.))))..)))))))))..))),(((({((.,.,...}}},,|||..(((.((((((((((.((((({{{{{.(((,,(((...........((((((..(((((.((((({....,))))).)))))..)))))}...,{{{(((({...||}}..((((((((..(.....)..)))))))){{..((((((((((((((((((.........))))))))){({{.((({{{{{{{|,,,)))}})))))),)))}.....,||..........)))))).)))..))...((((((((........)))))))))}}},(((((.....))))),)))..))).))}....)))))..)))))))))).)))....))))))))))}....((((((((((.((,..........{(((.((((({((((((((..{.(.((((((((.{(({.(((....))).))).)))))))).).}))))))))))....))).)))))).)))))))))),))))).)))))}{{{.((.(((({(((.....|||,..,}}}}))}}}}}...}}.}}},...........))))))))))).)))}...................,,,,{{{((({({{...,..,,|,{|}},,...,)))|{{..,,.,}),|||||,(((({{...{{{{{{{{||||..,......{((((((((((.,.........))))))))))).,{(((((....)))))|{{.((((....)))).)))},},.}}}}}},.)})))))))))).......(((((((((((........))))).)))))){({((.{{..,.)}.}||||,((((,,,,,,}}||,{..}|||||,}|}|{{||,||}|||},..}}}})))})).))))),}..}}})}||||,{{{|}}}||}|||,,||{((({...}))))))}},)))))))))},,.,.}))))},.,)}.)))),})))))))))))))),,))))}..)))))..)))).))..))).)))))))))}}))..|||(((({..(((((...(((((.(((({,{.((((((((({..((((...({.,(((({..((((((({...(((......)))..((((((((.,.....,}.)))))))),.(((((((((((((.(((........(((((((((((((((((((........)))))(((((......(((((((((((((.(((((..,(((((..((((......))))..))))).,..)))))......,(({(........)))}..((((((.((((...((((((...((((((((((({.((((((((((({.((((....)))}......,{({{{{.((.((((.(({{{((((.{{{....{,,...,,,,)}}..)))))))).)))).)){(((((.((.......})..)))))},((((((((.(((((........)))))..)))))))).,)))}}}.,.,)))).)))))))),..,......{((((((((..((((..,...(((((.{{...{{{((((((.((((((({{{(((.{.{(..{{(,,...}})...})..,.)))))))))))))}||.((((((....))))))|||{.....(((((..((({...})))..)))))...,)})))))}....)))))..,,)))).)))))))))..(((.{((.(((......))).))}.)))...,,{{....|||||,.......)))))),)))))..))))))...)))}...))))))))))))..))))))).....))))).....))))))))))))))..))))))))))...))))))..))))))))..))))),,))..))))}))))))))).})),})).)))))...................)))))..))))),.)))))))))))))).,,....,,.,},..,{{.(((((((.(((....)))))))))).}},...)))))))).})}}...{|||,..{||,,,,}}},}}))))),,})))).).))),))))})))).,.......,,......(((((...)))))}))))))))))))))))))))))))...{{((((((((((,......(,..((((({.....}))))).))...(((((((((((((.(((((.,((({...{{|},|,,.||.||,,,..,,),.}).,|,,..((((((((((((..((.....{(((((((..({.{((,((,,,,.,.....})},))}.))..)))))))}....(((.((((((.....)))))).))),{{{{,..,|,.||...,)),.,|||||.,,},}},.}}..))))))))))))..,,.)))))...)))))))))))))..)))))))))).}}...,||||....,)))))}),....||||||((((((({..((((.((((........((((((((.....))))))))........)))).)))).,{{{,........}},},|{{.....,,,((((((((...,{{.(((((..........(((((((.(((..((((((({((((.....{{(((,.,,,,|||,,.,.}||.||||.,|||{{{{(((((({,((({,,{{{,|||,|..((((......))))..,,})))))|,.}})..,,,},}..))))).)))))})))).}}..,,.)))))..).))))))))).))))))))))))})))))))))......))))).||}||{|||{{(((((.....))))).....)))))))))),,,.....}})})}.))))).)))),,.})}}..},..)))))))))))))))).)))..)))))..)))).....)).))))).))))).))))))))..)))))))))...))))}..(((((.........))))))))).,))))))))){((((.(({...,,(({.((((({(.((((...}))}..}).))))).}}}.,,,.,.)).))))))))))))))....))))....))))))))))))))))}.},|.{((((((((((.{{......,}.))))))))))}...)))))).)))))))...))))).)))))))))).)))))).((((((...((((((((((...((((..{(((((.,{(((,...,....((((((.((((((((((....(((((((........(((((.(((.....))).)))))..((((((..,,,....,,{({.,,...,{{{{{{{.(((((((((....(((..,..,(((({{,.,...|||},,.,{{{{(({{{{.|{{|,,{{{.(,..{((....)},.,})}},,.|||.}|||},.,,,},}))}})))}...,))),.))))))))),,..},}||,{(({((((({.....,||,,...)))..((((({.,{{.({..((((((.(((.....(((.((((..{{...}}..)))).))).....))).)))))))}}}))))))......}}}}))),.,}}}..,...)}))}}}}((((((((({((((((((.........)))))))|,,{(((((((((..(((((((((.,{((((,...,)))}..,..)))}}})))).))).(((((((.(((((((.((((.((((.((.(((((...........))))).)).).))).)))).)))))))))))))).{((((.(((({..{((......))}})))))))))...,,,.)))))}}}}},|,,,|{{.|||......,{{{{((((..((((({((,(((({,..(((((((((.{{...,,,(((((((((....)))))))))(((((.{((((((((.(((.(((...((((....)))}.......{{{{.((((((.....})))))}}}}.....,.)))))))))))},))}.)))))..,|,,...))...)))))))))})))}}})))))).)))))))).,,.....,.,.,.......................................................................)))))).)))))))......))}...,))))))).))))))....,,,,.}}|((,(({({,{(,,.,,..}},}.,,,...))}})))}})},,}||........,.)))))|(((((((((..(((...)))..)))))))))}...,,.{{,.((((((((...(((((((...{(,.((((.(((.....,{{.,,{{..,,.........)))}.,...))).))))),,})))))))...))))))))..,,)})),,,)))))))))).))))))..(((((((..(((({(........)))}})..,..)))))))..

Transcripts

ID Sequence Length GC content
GGCUCGGCUCCGUGGCCGCCGCUCAGGAGCCAUUUUGGACUCGGUUCAG… 11782 nt 0.4563
Summary

Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I (I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. Type II receptors are considered to be constitutively active kinases. This gene encodes activin A type IIB receptor, which displays a 3- to 4-fold higher affinity for the ligand than activin A type II receptor. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.