| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACCCUCCUGACCCCUGACCUCUGCCCCCAGUGGCCCUGGCCCCUGGG… | 1620 nt | 0.5747 |
This gene encodes a member of the cyclin-dependent protein kinase family. The protein promotes entry into S phase, in part by activating members of the E2F family of transcription factors. The protein also associates with cyclin C and phosphorylates the retinoblastoma 1 protein to promote exit from G0. [provided by RefSeq, Jul 2008]
A study in human menstrual blood-derived stem cells (MenSCs) identified the CDK3 as a differentially-expressed gene that was down-regulated with increasing passage number in vitro [Chen et al. DOI:PMC4713568]. A study in human skin demonstrated that the CDK3 was significantly up-regulated in thermally injured tissue compared to normal skin during the early wound repair process, as part of a broad analysis of 2,286 altered genes [Greco et al. DOI:10.1016/j.burns.2009.06.211].