Basic Information

Symbol
CDK4
RNA class
mRNA
Alias
Cyclin Dependent Kinase 4 PSK-J3 Cell Division Protein Kinase 4 Cyclin-Dependent Kinase 4 EC 2.7.11.22 EC 2.7.11 CMM3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000075.4
Sequence length
1865.0 nt
GC content
0.5201

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-667.30 kcal/mol
Thermodynamic ensemble
Free energy: -700.36 kcal/mol
Frequency: 0.0000
Diversity: 640.47
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........(((((((((..((((((((((((.(((.((((((((((......))))..((((((..(((((((.......)))))))(((((((((....))))..)))))....))))))..))))))))))))))))).....))))..))...(((.(((.((((((.(.((((...)))).).))))).)..))))))...((((.((.(.(((((....(((.....)))((.((((((...))))))))....((((((((((........((((((((((((((((((((((((((.((.(((.(((((((.((.(((((.......(((((.(((..((((....(((((....)))))....))))..))).)))))..))))).)).))))))).(..((((((.((((((((((((((((((.(((.(((((((((((.((.(((((...((((((....((((..((.....))..)))).(((..........((((.(((......))).))))....))))))))).))))).((((.....))))..(((((((.....((..((((((......))))))..))..))))))).((((((...)))))).....)))))))......))))))))).....((((((....(((((((...((((.((((((((((((..((((((((..((((((((((.(((((((.(.((.......)).).))))))).))).((((((((....((((.((((..((.((((..(((..((((((.((((........((((...((((((((((((...)))).))))))))))))...)))).)))).))..))).))))))..)))).))))...((((.((((((.......)))))).))))...))))))))(((...)))......)))))))))))))))...(((((.(((.((((.((.((..(((.............)))..)).)).)))).)))...)))))....((((((......)))))).))))..)))))))))))))))).)))..))))))((((((..((((........)))))))))))))))))...))))......))))))).))))))..)))))))))))).)))))))))).......(((((....)))))..(((((((.........................)))))))..)))))))))).......))))).))))).(((((.....)))))))))).))).)))).(((((.......)))))........))))))).............((((((.(((.(((((((((((((((((..(..((((.((((((((((((((.(((.(((((.....(((((..((.(((.....)))))..))))).........(((((((..(((..((((.(((..((((((..((((((.(((...))).))))))....)))....)))..))).))))))))))))))....(((((.((((((((((......)))).)))))).)))))..))))).))))))))))...((((((...)))))).(((((((.(((...)))...))))))).....(((((..(((((((((.(((((..........)))))((((.(((......))).))))...((((((....))))))....)))))))).)..)))))....((((((..(..(((..(((((((.((.........)))))))))))))..)))))).))))))).))))..)..))..))))))))))))))).)))..)))))).......
Thermodynamic Ensemble Prediction
.,{{{(((((((.(((((..((((((((((((,(({,((((({{(((..,.,,}|||{(((((((..(((((((.......)))))))(((((((((....))))..)))))....))))))}))))))))}})))||||{{{{{{{{{{{.{{...(((.(((.{(((((.(.((((...)))).).))))).}..))))))...((({{{{.{.,{{,|||||(((,,{{,|}}{(.((((((...)))))))}....((((((((({.....,((((.((((((((.((((((((((({..,,,.,{,.{{{...{.(((((((,.{{,.{((((((.,,(((((((,,{{((((({,,.,{{||{{.,((((({,(((.{{{{{.(((,,.(((((.......))))),,,...(((({.(((((((.....((.(((...((((|.||...,,.....,))))})}.,)).....))))))).))))).,,,,...,}}||.{{{{.{{(..,...})),}))}..,.))).))))).))).))}.))}....}}}}.{(((((((.....((..((((((,....,))))))..)).,)))))))||,{{{{{((((...((.((((((...)))))).))..))))|{{{{{((((((.{{{(,,,,}}}},||||,{{,|||||||,,{{(((,,,,,}}}||((((((((((((((..({...},..))))))).)))))),,,},|||||{{,....||||.||||}.{{.||||},|||}}|{(((({((((,.{{{{{.{((.,.(((((((((((({...}))).))))))))),},)}.)}))}))}}.}}..|||,||||||,.}}}}.||||...((((.((((((.......)))))).))))...}.))))||(({{,..}}.{{{,{||||||{||||,|,}.{{((,,,.|||},,,,,,|}||}}|||..........,{{,,,..||,}|{||||{,|,...|||||{{{{(,,{((.,,,..||||,,.,,,,}})),,}))))),,,,))}))),})))),)||||||.}||,,.}}}.})}))))||,,,,)).)}}}}}((((((({...})))))))}}}}),|}}))}|((((((|...}))))))}.,,))),))))},.......,.,}}}}}|.,},..........}}}}}}}.....,}))))))))))).)))))))))))}))))).))))).{{||{,.,,..}}},}})}}}}},.,{((,{..,.......,)))),..........|,|||{{{{{{{,,,.{((((((..,...||||||||}||||||,..}}}}|,|||||{{({{(((((({.(((.{((((....,(({{{..||,{{{,,...))))),.}}}||,,....,,,{{{{{{{..|||..{{({.(((..((((((..((((((.(((...))).))))))....))),...}))..))).}})})))))))))}....(((((.((((((((((......)))).)))))).)))))..}}}||,|||,}}}))))})||||,|}}|}}|)),,|||||||.|...},)))}.{|||||||{{{{.((({,.,||,|||,,,.,,,,...........}))))||||},,({{{...},)}))}}...((((({....,)))))..,,))})))))})}.,})))}},.}}}},,}}}}}.}}}}}}|||,,.|||,..,,|.,||||||||.,,...)),,,)}|}{(((((.....)))))),,,.......,,,,||||.|....)))))}...,)))

Transcripts

ID Sequence Length GC content
AGCUUGCGGCCUGUGUCUAUGGUCGGGCCCUCUGCGUCCAGCUGCUCCG… 1865 nt 0.5201
Summary

The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008] CIViC Summary for CDK4 Gene CDK4, along with its partner CDK6, are key players in cell cycle progression. The complex has been implicated in a number of cancer types, and is the focus of therapeutic research and development. One targeted therapy for CDK inhibition is palbociclib, which may slow the growth of advanced stage breast cancers. It has also been shown, in mouse, that CDK inhibition may sensitize mutant PIK3CA tumors to PI3K inhibitors.

Forensic Context

A study in humans demonstrated that the CDK4 was upregulated in the plasma of coronary artery disease patients and showed the highest predictive value for diagnosis with an area under the curve of 0.91 in receiver operating characteristic analysis [Abdallah et al. DOI:10.1007/s40291-022-00622-1].