Basic Information

Symbol
CDK5R1
RNA class
mRNA
Alias
Cyclin Dependent Kinase 5 Regulatory Subunit 1 P35nck5a Nck5a P35 Cyclin-Dependent Kinase 5 Activator 1 TPKII Regulatory Subunit CDK5 Activator 1 CDK5R Cyclin-Dependent Kinase 5, Regulatory Subunit 1 (P35) Cyclin-Dependent Kinase 5 Regulatory Subunit 1 Tau Protein Kinase II 23kDa Subunit Regulatory Partner For CDK5 Kinase Neuronal CDK5 Activator CDK5P35 NCK5A P23 P25
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_003885.3
Sequence length
3948.0 nt
GC content
0.5415

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1482.20 kcal/mol
Thermodynamic ensemble
Free energy: -1555.34 kcal/mol
Frequency: 0.0000
Diversity: 1053.25
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((((....(((((.(((.((((((((((.(((.(((.(((((.((((..(....((((........)).)).....)..))))...)).))).)))))).))))))))))))).)))))((((.(((((.....))))).)))).(((.(((((........))))).))).)))))))(((((((..((((((((.((....))...))).)))))((.(((((((((((((((((....)))))).((((((((((((((((..((((((..(((((.(....).))))).)))))).((((((((........))))))))...(((((((.(((((((((..((((.(((((((....))))))).))))...((((((........(((.((((.((.((((.....(((..(((.......)))...)))................((((...((((((......((.((((((...)))))).))........))))))..(((((.((......)).)).))).............))))((((....))))..............))))))))))))).....))))))........(((((((..((((...)))).(((.((((..(((......)))...))))...)))...))))))).((((((((.......((((((((...((((.(......).))))(((((((...((((....))))...))))))).((((..(((......)))..))))((((..((((((((((((((((........((((((.(((((((..(.(((.(((..(((...(((.(((.((((.....))))))).)))...))))))))))..))).))))))))))...)))))))..((((.((((((((((.((.((((((((((((((((((.......((((((((((((.....)))))))(((((.(((.....)))..))))).)))))........((((((((((.....(((((((.(((((((((.((((((((((((((((((((.((.((((.(((((.((((..((.((.(((.((...(((......)))...)).))).)).(((......))).(((((((((....((((.((((((......)))))).....(((....((((((((((((........).))))))).))))....)))))))(((.(((((((.(((...((((((...((....((((((((((....(((((....)))))..((((((((((..((.((((......((((((.(((.(((....((..........))....)))))))))))).((((....((((.((....)).))))....))))..)))).))..))))))))))...)))))))))))).))))))..(((.((..(((..((((......))))..)))..)).)))....(((..((((.((((.((((.....)))).))))...)))).)))))).)))))))...)))..(((((((((((((((((((((((((...(.(((((.......))))).)...))))))))))))))))))))))))).)))))).)))....))..))))))))))))))).)))..(((((((((.(((......))))))))).....)))....((((((.....))))))..))))))..))))).))))....))))))))))).....)))..))))((((.(((((....))))).)))).))))......(((.((((((((....)))))))).)))((((((.....))))))...(((((((((((((((((..(((....((((....))))..(((((((.......)))))))((((((...((((((................)))))))))))).))).))))))).(((((((....)))))))...))))))))))(((....)))..))))))((((((...(((..(((....))))))...)))))).((((..((((((((.(((((((((.(((((((((((.((....)).))))))...(((.....))))))))....)))))..))))...))))))))))))))))))))...)))))))))))))))))))))).)))).....(((((((((..(((((........(((((((....)))))))..((((((((....))))))))(((((...)))))((.((((((((((((.((...((((((.(((((........((((((...)))))))))))))))))...)).)))).))))....)))).)).((((((((((..((.(..(((....)))..).))..).))))))))).((((....)))).................((((...(((((.((...((((.(((((.(((((((((.((((.........((((((((((........))))))))))........((..((((.......))))..)).)))).)))))))))))))).)))))))))))...))))))))).....))))))))).))))))))))))).........((......)))))).))))...((((((((...........))))))))..............(((.(.((((((......)))))).).))).)))))).))...))))))))))))))))((((((....))))))....)))))).))))))))))..(.((((((..((((((((.((......((((..((......))..)))).......)))))))))))))))).)))))))))))).))..((((((.((((((((((((.........))))((((...((((((((((.(((((.((((((.((....(((((.(((((.(((.....))).))))).))))).....)).))))))((........))...))))).)).)).))))))....)))).(((((((.(.(((.((((((((.....)))))))).))).)((((...)))).)))))))....((((.....(((.(((((((((....((......)).....))))))))).))).....))))..(((.((((((((.((((.....))))))))))))))))))))))).)))).))(((((.....(((((((.(.((((((((..(((........))))))))......))).))))))))...))))).....(((((((((((.((((.(((......(((((.((((((........(((((((.(((((((.....((((.((((((((.((((..(((....(((((((((.........(((..(((((.(((.((((.......))))))))))))..)))(((.......))).))))))))).....)))..)))).)))))))).))))...)))))))..................(((((((..........))))))).((((((....((((........))))..(((((((.........(((.(((((((((...)))))))))...)))..........)))))))........))))))..((((((....)))))).....((((((...(((((((........)))).)))......))))))..))))))))))))).......))))).....)))))))...))).))))).)))))))))).(((.((..(((((.(((((((((((((...))))...(((.((((......((((..........................))))......)))).)))))))..))))).)))))..)))))...
Thermodynamic Ensemble Prediction
.,.{((({{..,|||(((((.(((.((((((((((,(((,(((,(((((.(((({.{{...{{{{......},}}.|||,.,,,|.||||,},}}.))),))))}}.))))))))))))).)))))|{||.{{||||..||))}))|))||.(((.(((((........))))).))),{(((((({(({(((..({{{{|{|,{{,,,,}|,,{}}}.}})))|{.((((((((((((((((,....,))))).((((((((((((((((..((((((..(((((.{....},))))).)))))).((((((((........))))))))...((((({{{(((((((((..((((.(((((((....))))))).))))...(((((({.......||||{|||.{.,{{((.....{((..(((,,.....}}}...|||................||||||,((((((......((.((((((...)))))).))........))))))..(((((,{{...,,,||.||{}||.{,......,|..|...((((....))))...,}},.,.}}}.)))))}}))))))....,}}}}}}..,,{{{{(({{{.{..((({..{(||{,((.{((((..(({,(((((((((.{,({{,....},},|((({{{..{{{{,.,....}..}))))||,..{((((.(......).))))|((((((...((((....))))...))))))}.,|.|.))))))....))))}),)))})|,..{((((((({((((((.....,..((((((.(((((((..,.(((.{{(..{((...(((.(((.((((.....))))))).)))...))))))))))..)))}})))))))))...))))))){.((((.((((((((((.((.((((((((((((((((((.......((((((((((((.....)))))))(((((.(((.....)))..))))).)))))........((((((((((.....{{((({({(((((((({,((((((((((((((((((((.({{((({{((((((((((..{,.((.(((.((...(({......}))...)).))).)).(((......}||,(({((({{(...{((...((((((......))))))..},..{{....((((((((((((........}.))))))).)))).,,.))||||{{{.||((((((,{{{,,.{(((({..{(,,..,((((((((((..{.{((((....))))),.((((((((((..((.((((.....|{(({{,.,,{{((|.....}}},.,,,,.||{.{,,,}}}|||||,,...,,|.,,,{{{{.||,,,,}),))},..,,)),...)))).))..))))))))))...)))))))))))}.))))),..(((.{(..(((..((((......))))..)))..)}.})).,|,({{{{((({.((((.((((.....)))).))))))})))},)))})).))))})),,.,,,..((((((((((((((((((((((((,...(.(((((.......))))).)...,)))))))))))))))))))))))).}}|}||,}},....}}..))))))))))))))).)))..((((((((,{(((......))))))))).....)))..,.((((((.....)))))),.)))))}..))))).))))....)))))))))))..,}.))}..}}}}((((.(((((....))))).)))).))))......(((.((((((((....)))))))).))).{{{{{,....}))))}..,(((((((((((((((((..,{{,,,.((((...{||||..{{{{{|{,|.....))}))))((((((...((((((..,,,,......,,,,)))))))))))).,,).))))))).(((((((....)))))))...))))))))))|||....)},..))))))((((((...(({.{(((....))))))...)))))).((((,,{{{(((((.((((((({,.{{(|(((((((.((....)).))))))}..{{|.....)))||||,....,))))..))))...))))))),)))))))))))}..,)))))))))))))))))))))).)))),,,..(((((((((..(((({,.......(((((((....)))))))..((((((((....))))))))(((((...))))){{.((((((((((((.((.,.{{((((.(((((........((((((...)))))))))))))))))...)).)))).}}))....)))).}}.((((((((({..((.,..(((....)))..}.))....))))))))).((((....))))........,........{{{{...(((((.{...{((((.(((((.(((((((((.(((,....{{{{.((((((((((........))))))))))........,,..{(((....,,,,}}}}})).,))).)))))))))))))).))))))))))).},)))))}))),....))))))))).))))))))|||}||......,}||,...,,}},))))))))..,{(((((((...........)))))))}..............{{|,|,((((((......)))))).,.})).))).))).}...))))))))))))))))((((((....))))))....))))))}}}))))))))..,.((((((..(((((((({((,,{({{(,{(,.,,..,.})))}.)),)},.....,,)))))))))))))).}))))))))))).{{((({,,,(,,..{{((({({.((((({(,({({{((,{,..,||.||||{{{....|,|{{{{{,{{,.,.(((((.(((((.(((.....))).))))).))))),..}}))})))))}.}}},.,,,,},}})))))))),.||,|||}}|,,||,,,.,||||{|||({((({((({((((,,,,,||}}}})),)))})|.||.,})),)}}),,,,)})}}.)))}})))}|(.(((((((((....,{......,}.....))))))))).)||{{,{{{{.|,.(((.((((((({{((((.....))))))))))))}}},},}))}}..)))}|.(((((.....(((((((.(.((((((((..(((........))))))))}.....})).}))))))).,.)))}}.,,,,|||||{||||(.({({{({{..,,,,{{{{,,((((((,,......,{{{{{{.{{{{{{{.....{{{|.{{||||||.{{{{..|||,.,.|{(((({{|,......,.{((..(((((.(({{((((.......))))))})))))..))|(((,...,}})}.,)))))))}|.,,,.}}}..}}||,}}}}}}}}.}}}}...}}}}}}}.........,,{{|,...(((((((..........))))))),|||{{{...,((((........))))..(((((((.,.,.{,..(((,(((((((((...)))))))))...}}}....,,,...}}}}})}.....,,,}))})}..((((((....})))}}....,((((((...(((((((........)))),)))......)))))}.}}))))}}}}}}}},{|,,..},,,)}},..)))))))...))),)))}),))))}}}}|{{{({{|{.{((,,{{{{,,,}}|}|,||}.,,)))}}}{||.{|||.,}}}}||,,......................,,,.}},,..,,},})))})),.,....,}}}},}))))})}}}.,...

Transcripts

ID Sequence Length GC content
AGAAGCUCCCUAGCUGCCGCCGCCGCCGCCGCCGCCGUCGCCGCCGCCG… 3948 nt 0.5415
Summary

The protein encoded by this gene (p35) is a neuron-specific activator of cyclin-dependent kinase 5 (CDK5); the activation of CDK5 is required for proper development of the central nervous system. The p35 form of this protein is proteolytically cleaved by calpain, generating a p25 form. The cleavage of p35 into p25 results in relocalization of the protein from the cell periphery to nuclear and perinuclear regions. P25 deregulates CDK5 activity by prolonging its activation and changing its cellular location. The p25 form accumulates in the brain neurons of patients with Alzheimer's disease. This accumulation correlates with an increase in CDK5 kinase activity, and may lead to aberrantly phosphorylated forms of the microtubule-associated protein tau, which contributes to Alzheimer's disease. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.