Basic Information

Symbol
CDK6
RNA class
mRNA
Alias
Cyclin Dependent Kinase 6 PLSTIRE Serine/Threonine-Protein Kinase PLSTIRE Cell Division Protein Kinase 6 Cyclin-Dependent Kinase 6 EC 2.7.11.22 EC 2.7.11 MCPH12 CDKN6
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001145306.2
Sequence length
11663.0 nt
GC content
0.3970

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3188.60 kcal/mol
Thermodynamic ensemble
Free energy: -3422.33 kcal/mol
Frequency: 0.0000
Diversity: 3387.94
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((((((((((((....))))))......((((((((.(.(((.(((((((((.......((..((((((((((.((((((...(((((.((((((.(((((((.((.((..(((((((((((.((((.(((....))))))).)((((.((..((((((.(..(((((...(((((((((((..(((((......((..((.((.((.((((.(((((((....))))))))))).)).)).)).)).(((((.....))))).)))))..))))))))).))...)))))...).))))))..)).)))))))))))))))).))))(((((((.(...((..((((((......(((((((....)))))))..((((.((....))))))..))))))..))...).))))))).(((((.(.((((((((.....))))))))).)).))).((((((((.(.(((((((.(((.(..(((.((((((..(((.((((((..(((((.....(((((((...((((.((((((((..(((.((((.(((.((..((((((....))))))....)).))))))).((.(((....))).))(.(((((((..(((((.(((((..(((((((.(((((((..((((.(((...(((((..(((((.((((......(((((((((((..(((((((((...(..((((.......))))..)....(((((..........))))).)))))))))....))))))))))).(((((((..(((((.(((((.(((((((......(((((((((((.....))))..)))))))...)))).)))))))))))))...........))))))))))).......(((........))).(((.((((.(((.((..((((.(((.........((((....)))).))).))))..))...))).)))))))(((((.(((.(((((.......))))).)))..)))))...))))).....))))))))))))..)))))))..)))))))...))))).).))))((((....))))..((((((((.(((...(((((((((((.(((.((((((.......((((.((((((....))))))...)))))))))).)))...))))))))..))))))))))))))))))))).)..((((((((((((.....................))))))))))))..(((((((....(((.((((......)))).)))....)))))))............)))....)))))))).))))..))))))))))))..))))..((((((...))))))((((.........))))(((..((((...((((((.((........((((((.((((....))))))))))((.(((((((........))))...))).))........)).))))))...))))))).((..(((((.(((((((....))))).)).)))))....))..)).)))..)))))))))..))))))))))).).))))))))(((......))).......(((.(((....))).)))))))).)))))).))....((((..(((.......................)))))))((((((...)))))).(((((((((((..((((...((((.((.((.((((((...........)))))))).))))))..(((((((........(((...((.(((..((......))..))).)).)))((((((((((((..(((((.........((((.((.((((.(((((....(((.((((((((((.(((......(((((((((....)))))))))......)))(((((((.....)))))))...((((((((..((((((...((((((((((.(((((.......))))).))))).......))))).....))))))...))))).)))..........((((.....)))).(((((((((......(((((.....)))))..))).))))))........)))))))))))))..((((((((....)))).((((((((....))))))))..(((((((...........)))))))...((((((.....)))))).........))))..(((((....))))).......(((((...)))))(((((..((((........))))..)))))(((.....((((.((((((((((((((.....((((((((...((((((.....(((((.......)))))..))))))...))))))))...((((..(((((((...(((((((.....((.((((((((((.(((((....((((...((..((((((((((...((((((((.....))))))))...)))))))))).))..))))....))))).............((((((..(((((.(((......))))))))))))))....(((.(((((((...((((((((((....((((((((.((.((..........(((((((((((.....((((((((((((.((((.((..(((((((.....(((((...))))).(((((((((....((...((((((((((((.((.....(((((((..(((((((((.....(((........)))..((........))...(((((((((((.....))))).)))))))))))))))..))))........)))....))..))))))))))))..)))))))))))((((..(((.(((..((((((((((.((....)))))))))))).))).)))..))))...(((((....(((((........)))))...(((((((((.......((((((..((((....(((((((.(.((.((..(..(((((....)))))..)..))))).)))))))))))))))))((((((((.((((((((((((((......((.((((......((((((.(((((((.((((((((((.(((((.((.(((.(((((..(.(..((((((((.((.....)).))))))))..).)..))))).))).))..(((((((.....((((((............))))))..))))))).(((.((((((((((((((((((...((.((.((....)).)).)).)))))).....((.((((((.....(((.(((((((((((..(....)..))))))))))))))..)))))))).((((......))))......(((((((....)))))))...(.((((((....(((((....((((((.(((.(((((.((......((((.((((((..(((((....))))).....)))))).))))...)).)))))..))).))))))((((((((((....))).(((((.((((.((..((((((((((.....))))))))))..))....((((((((.(((.......))))).))))))..(((..((((..(((((...(((.....)))....)))))...))))..)))((((((...))))))......(((((((((((((.(.(((....((((((((.(((...((((...((..(((.....((((.(.....).))))...)))..))..)))).....))).))))))))..))).).))))))))))))).....(((((((((((......(((((((..((((..(((((((((((((((((.(((((((......((((((.((((((......................)))))).))))))))))))).)))))...)))))))...............(((((((........(((((((.(((...))).)))))))..)))))))...((((......))))....(((((..................))))))))))))))..)))))))....)))))))))))..((((((....((((((.....(((...((((((((....(((.....(((.(((....((((..((((.(((((((((((....(.((((((((((.((((((((....(((...)))...)))))))).))))...((((((((((((..((((((((....((((..((..(((((((((.....(((((...)))))...)))).)))))..))))))....))))((((........))))))))))))))))))))..........(((((((..((.........))..)))))))....)))))).)......)))))))))))..))))..))))))).))).....)))))).)))))...)))...))))))....)))))).)))))))))...)))))))....((((....)))))))))...)))))).)...........)))))))))))).)))......))))))))))))))).....((((((.........))))))...(((((((........))).))))((((((.(((((((((.(((((((((((((((.((..(((((.......)))))..)).)))).(((((.((.....(((((((..(((((((.....))))...((((((((.(((...)))...............(((((...((((((......))))))....))))).((((.....))))))))))))(((((((.((((.(((((((....)))))))......(((.(((((((((((..((((((((.....))))..))))..)))).(((((((.....((((.(((....)))))))))))))).((((((((...(((((((((.....))))))))))))))))))))))))))).(((((((.......))))))))))).)))))))(((((((....)))))))(((((...))))).........)))..))))))))).)))))..........................((((((.......))))))......(((.(((((((((.......))))))))))))........))).)))))))).)))..))))))..))))))(((((.......((((((...(((...(((((...(((((((....)))))))...)))))...)))....))))))...))))).....(((((((.((..(((......)))..)).)))))))((((.((((....))))..)))).((((...))))))))....))))))))).....))))))...............)))))))))))....))).))))))))...)))))))))(((((.(((((...))))).)))))..(((((((.(((..(((.(((....((((((((((((((.....))))..............((((.((.((((.....((((((........((.(.(((....))).).))......)))))).....)))).)).))))........(((((.......)))))((((((.((((..((((.....))))..((((((((((..(((.(((.(((.....))).))).)))...))))))))))((((...((((((.............(((((((.....((((((((...(((((..........)))))...))))))))))))))).((((.((......)).)))).....((((((..........(((((((((((.((((((((((.........((((((((.((((((.(((((((((((.((((.(((......))))))).))))))))).......)).))))))((((..(((((.((((.((..(((.((((((......((((((..(((((.((((((((((((...((((((....((((((.(((.((((((........)))))).....))).)))))).....))..)))).)))))))).......(((((((((((.(((((((.(((((.............(((((((((((..(((((((.....)))))))..)).............(((((((...........))))))))))))))).).............))))).)))))))))))).)))))).......((((..(((.((((....)))))))..))))((((((.................))))))........(((((((((.....((((((((((...((.((((....(((((((((((..((((((((...........(((((((................(((((((((....(((.((((((........((......)))))))).))).))))))).))..............))))))).....((((((((....((((((((((((((((....((.....(((....................)))...))...))))))))).....)))))))..........(((((...............)))))(((((((((((((((((...........))))))))...(((((((.........)))))))..............)))..)))))).......(((......))).........)))))))).))))))))..))))))))..........(((((((((.........(((((((((((((((..((((((((((....(((((((((...(((.(((((((((.............................(((((((((....((((((....((((((((((.((.(((((((..(((((.....(((.(((....))).))).....)))))..((..((...((((((((...((((((((...))))))))...))))))))...))..))(((((..(((((((((.........))).))))))(((((((((....)))))))))...(((....))))))))...................(((((((((((((..((.(((((..(((((((....)))))))........))))).))..))....)))))))))))............((((((......))))))...................))))))).)))))))))))).....(((....)))...............))))))((((.((((.((....)).)))).))))..((...))......)))))))))...........(((((((((.((((....)))).)))))..)))).........((((((......((.((.((((((.....))))))))))...))))))...)))))))))(((((((...)))))))(((((((((((((((....(((((....(((..((((.....(((((.((((..(((......(((((.((............(((..(((......)))..)))............)).)))))....)))...)))).)))))...))))..))).....)))))(((((((((.((..((.(((.....))).)).)))))))))))((.(((((.((((....)))).)))))))...((((....))))..((((((((((.(((((((...))))))).....(((((.((((((...((((((((.....((((((((((((.(((....((..(((.........)))..))..))))))))))))))).(((((........))))).........(((((....)))))......(((((((((((((((((...........))))).)))))..)))))))((((((..((((.(((((((((((..((((...(((((((((...))))))))).))))..))))))))..........(((((((....(((((((.........)))))))))))))).....(((((((((..(((....(((((.....))))).((((.(((.......)))..))))...)))..)))....)))))).....((((((((...((((((((((.((......(((((...........))))).)).))))))))))..........)))))))).......((.((((((((((((((((.(((((..((...(((........)))...))...(((((((((((.....((((....)))).......)))))).))))).....((((((.(((((..(((((..((((((((.(((((((......((((....)))).......)))))))))...............)))))))))))..))))).))))))...(((((..(((((.........(((((.((.........)).))))).........)))))..))))).........))))).))))))))..)))))))).))...))).))))..))))))................))))))))...)).))))...)))))....((((.((((((.....(((...)))...))))))))))...((((((....)))))))))))))..)))........(((..(((((((((....((((((.(((.........))).)))).))......((((....)))).....))))).))))..))).)))))))))))))))......((......))...(((((.(((.((.......)).))).))))).)))...))))))))).....))).)))))))................)))))...))..)))))..))).(((...((((((((.........))))))))...)))............))))))))).)))....)))).)))))...)))))))...))))))))))))))))))..)))))).....))))))......)))..))..)))))))))))))..........)))))))).((..((((((((.(((.((.(((((........)))))...)).))).))))))))..))....)))......))))))).).)).))))))))......))))))...))))))....))))......(((((((........))))))))))))))))).............))))))))))...))).))).))))))))))))))).))))))).)).)))).))).)))))))))))))).)))))))).))..))))))))((.(((...(((((....)))))))).))(((((........)))))..))))).)))))))))))).)))...(((((.((........)).))))).....(((((((..(((((((..(((...........))).)))))))))))))).........)))))))))).))...))))))))))))))...))))((((((((.(((.............))).)))))))).)))))))))........((((((((...((((((((..(((((....(((...(((((.(((..((((.((..((.((((((((((((((((((((((...((((((((.((..((((((((((......))))))).)))..))..))))))))...)))))((....))...(((....)))((..((((((((((((..((((((..(((((((((((.....))))).......))))))...))))))....)))))..))))))).)).............)))))))))((((((.........)))))).((((((((.((((((((((((......))).))))))).)).))))))))((((((.(((((.......)))))..))))))............)).)))))).....))..))..))))...))).)))))..))).....))))).))).))))).....))))))))....))))).)))).....))).))))))))).))))))...))))).))).)))))))))..)))))))(((..(.((((.(((((((((.....(((((((((((......(((((.((((....(((((.((((((...((((......))))((((......))))....((((((.......))))))....((((((((((((((..(((((((((.....((((((((.....((..((((.........))))..))......))))))))....))))).)))).))).............((((....))))....((((((.(((....))).)))))).(((((..(((((((((.((((.(((...))).))))...)))))))))...)))))..............)))))))))))...)))))).)))))))))..).))))....((((((........))))))..))))).)).))))....))))).)))))))).)..)))..)))).....))))))))))).((((....))))....)))...)).)))).))..))))))))..)))))))))))))))...))))))))..(((.....((((((............(((((((..........))))))).((((.(.((((.......)))).)..)))))))))))))...(((.(((((((.(((..((((((((.((.(((((((..((((((.......))))(((.(((((........))).)))))..((((((((.((((((((.((((((.((((.((..(((((((.(((....))).)))))..))..)).)))).......(((((.(.((((((.....)))))).).)))))...((((((((......(((.((.......(((.......))).......)).)))..))))))))............((((...((((((.(((......))).))))))..)))))))))))))))))).))).)))))........(((((((((.(((.........))).)))))......)))).))..))))))))).)))))...)))..((((.((((....((((((((((((........))))))))))))..)))))))).....))).))))))).)))....)))))))......)))))))..(((((((.(((((((((..(((((..((((((((((((((((........)))(((((....))))).(((...........))).......(((((...))))))))))).))))))))))))(((((((..(((((....)))))..)).)))))........))))))))))))))))..(((((..(((((((((((((...((((((........(((((((((......)))))).)))........))).)))...))))))))....))).))....)))))..
Thermodynamic Ensemble Prediction
((((((((((((((((((((....))))))....,.((((((((.{.(((.(((((((((,,,....((|.((((((((((.((((((|||((((({(((,,,.,((((,{,{,.{{,,{{{||||{((,.,|||},,{,,,.}))}))).||||(|((..,{{{{{|||,((((({({((((((({((({.(((,(((({((((.((,(((((,{((((((((((((....)))))},{(((((.((((((......,....))).)))))))))|{{|||||}))).|}|..|||||||.|.|||,,..})).||||||}}},))))|||.||,(((((((.{,..((..((((((.,....(((((((....)))))))..((((.((....))))))..))))))..)),,.,.))))))),||,.,.|,((((((((.....)))))))}|{||{|||{{|{|||,|.,.{{||||||||||{|,|,..,{{{|,..,...}}}}}}||{||.,}{((,((,((((({..,(((((((.((((((((((((((.......(((((...)))))))))))),|||,|(((((.((((((,{((((.((({.(((((((,.(((((.(((((..(((((((.(((((((..((((.(({..,(((((..(((((.((((......(((((((((((,.(((((((((...{..((((.......))))..}....(((((........,,))))).))))))))).,..))))))))))).(((((((,.((((,{(((((.(((((((.,....(((((((((((.....))))..)))))))...)))),}))))))))))))...........)))))))))))..,,...,,,........|||.{,.|||{{.{{{.{{.,((((.{{,........,|||(.,,.|||}.,}).)}}|,,||...}}}.}})))))(((((.(((.(((((.......))))).)))..)))))...))))),....))))))))))))..)))))))..)))))))...))))).),,)))((((....))))..{(((((((.(((...(((((((((((.(((.((((((,,,,,..{{{{.((((((....)))))).,,)}}))))))).))).)))))))))}..))))))))))))))))))))),,.{((((({(((({{....,,.,,,,,,........})}}}}}}|||}..{{{{{{{,...(((.((((......)))).)))...{||||||||||...,{{{{...{{{{{{....,,||{{..{{{.{{{{.||||||||,.,.,{(((((...}))))},)))}...,,,...{(((((({(((({{{|,{||,|.|,}|}....((((((.((((....))))))))))..((({((((,,{(,,..{{{{.((({..{({{{,,,,,..,||}|||{{.|(((...,})}}|,,|}}|||||(({{{{{||||{||{{,||...(((((,...}))))),})),)))}))),,)))))))})},)))))).}))}..|.,},}.},,...,{({((({{{{|||.{{{|||||{|,,{{{.|,...}}}}|},,,...,,,.......,..|,,.}}}})}})),,((((({...})))))..,|||||,|))})}|||,{{((((.((.({,((((({...........}))))))).)))))),})},))))).})))))))..((((((((....(({...)))...)}.)))))),,|||||||,,..|||||}}}}}{(((((((((.(((({{(({(((({({(((((((((((((((((({{,,.(((((((((.,,{|||||||||{{({((((,(((((((.....}}}}}}}|||}.|,||||,|||{{{{,,.(({(((((((.{{{((,,,....})))}.})}}}.{{{{...)))).....||}|||,{.,....||||,|,,......,{{{...,,||}|,(((((((({,{,...(((((.....}}}}}.||||,|}}}||,{,,,,..,|}|||}|||{||,,{(((((({....,}},.((((((({....})))))))..(((((((...........))))))).{,{{{(((.....))))}||,,,{,..,{{{,,.(((((....))))).......{((({...)))),,,((({{(({{{{......,,,,..)))))))))}.,|{{||.|{{|||{|||||||,,,..{{,{{{{({,,{({(((,,...{{{{,..}},,,}}})),,}))))),,,))})))))}}|||||}.|{,{{{{||||||{{{{.....{({(,(((((((({((({,....,,{{,...,,.,((((((((((({((((((((.....))))))))))))))))))))|{{{{{{||,..,{|||||.............((((((..(((((,(({......}))))))))))))}......((((........||}|..{{{{..,,{{,,{{,,..,,.,}}},......,{{||||((((...,.{{{,,,(((((,((((,.,({,.({((((.....(((({...}))))..,...||}|,..,}|}...}}}}.}}}}),..,|,||,,|}}|..,,{(((((((,(({{{((({.......((((((.......(((((({(((((({((((.....}}))}.}))))}},,,,,,,...,,.....))))))......)))))),,,,,.,,|,....{((((((({.((((..((((((((((((((((((.({....)))))))))))).,,...,,....,,..,(((((,.(((((((.{{,..,,....}}{{(((((((((......{((((((..{,,,...,(((((({.(.((.{{...,,(((((....))))),))..))))).)))))))),},)))))}{(((((((.((((((((((((((....,.((.((((......(((((,,(((((((.((((((((({,(((((.((.(((.(((((..(.{..((((((((.((.....)).))))))))..}.)..))))).))).))..(((((((.....((((((...,.....}..))))))..))))))).{{{.(((((((((((({(((((...({.((.((....)).)).)).)))))}..,{{((,((((((.,,,,(({,(((((((((((..(....)..)))))))))))))).,))))))},,||||}},,,,|||,......(((((((....)))))))...,,||||{|,{{{{{((..{,.{(((((,(((.(((((.{,,,{...((((.((((((..((({,....,))}},,,..)))))).))))...))})))))..})}.))))))||||{{|}...,....{{{(({{.{{{{.((..((((((((((.....))))))))))..))....((((((((.(((.......))))).)))))).{(((..((({..(((((...(((.....)))....))))).,,))))..))|{(((((...)))))}......(((((((((((((.(.(((....{{{{((((.{,{...{(((,..((..(({.,.,.((((,(,....).))))...))).,)),.})))},...,}),)))))))),.))).).))))))))))))).....(((((((((({......(((((((..((((..(((((((((((((((((.((((((,.....{((((((.((((((...............,,.....)))))).))))))))))))).)))))}..,}}})))...............{{{((((,,,.....{,{{{{{{(((...,}},)))}})),.)))))))..,((((......)))}.,..{{{{{..,........,.....,)))))}}))}))))..))))))),...)))))))))))..((((((....((((((.....(((...((((((((...{((({...(((({.(((((((((((((.,.{(((....,}}}}...,.,,(((((,,,.((((((((....(((...)))...))))))))}))))...((((((((((((,.,(((((((....((((..,({((({({((((.....(((({...}))))...)))),)))))..,,))))....))))((((........))))}))))))))))))))).,{,...,},(((((((,,{{.........}),,)))))))....))))))).))}}})).))))),}},,,)))}..}})))}}.|||{...}))))))}})}))...}))...))))))....)))))).,}}}}}}}}},,}}))}}},...{{{{....)}},.|||,...,,,,))}........,,..)))))))))))).,},......)))))))))))))))..,..((((((..,......))))))...(((((((........))).)))){(((((.((((((,((,((((((((((((((,.((,,(((((.......}}}}},,||,|||,,{((,,.{{,,...||||||{.,,{,{||{|||,{||}}...,,{{{{{{.||},,}|}|,.....,,.....,,(((((...{(((((......)))))}....))))).,,,{|||{..|,|||},||||(((((((,(({{.(((((((....))))))}....,,(({,((((((((.....}))))}})}|{{{{((({{|,|{{{|||{{(((((((.....((((.(((....))))))))))))}}.{((((({{...(((((((((.....))))))))))))))))},,|}}))}}},,||||||.,},,||}|||||}|}||,|||,,||{{,||||}},,}))}}}}|{{{|,,.))))}.,....,,,}},..))}}}}|{{{{{,,,....}}}}},....,}}}}}}||....,||||,,.,}}}},}))),,.,..(((.(((((((((.......)))))))))))).....}}))))))))))))).)))..))))))..)))))|(((((..,{,{{{.(((,...(((...(((((.,.(((((((....))))))).,.)))))...)))}}}.,})}))}..))))),....(((((((.{{..(((......)))..},.))))))),,,,.((((....))))..||||.{(({...)))}))),...,)))))))))..,..)))))).,,............)))))))))))....))).)))))))}...))))))))).}}.(((((......(((((((((({.{..,{((({{(({({{((((....||}}}}}.}},.,})))))}|||,,.....,,||,..((((.{{.((((...,.((((((.....,..((.(.(((....))).).))......)))))).,...)))).}}.)))),,....(((((((.......)))))))((({.......((((.....))))..((((((((((..(({.{{{.{((.....}}}.}})})))...))))))))))..,...,}}|..({{.....}}}...{{{{{{{.....((((((((...(((((..........)))))...))))))))}}}}}}}.((((.({......)).))))...{{{|,,})))}........})))))))))).....))))).,}))))))).)}))},.((((((.{((((((((((.(((,{(((......))))))).))))))}},...,,},}).)))))).,}}))))))..)))).})))))))}...,,......,,......,,,,......((((((((...{{{(((....((((((.(((.((((((........)))))).....))).)))))).....))}.}}}}.)))))))).......(((((((((({,(((((((.(((((.........,,..{({{{{((((({....,,...,,..,.{||{|.{{......)).,}}}}(((((({.,,..{{{,,.,},}}},}})))))).),.}}},,,,.,..))))).))))))))))))}})))))}}}}}}.|)},}}|||}|.|}}....))))))}...)}||,|||,}}}}}}}}}}},.,)))|||{.....}}}}.,,{{{{{|,,|,,,|}|,|}))},,.||.||||,,,,|||||||||||}||{{|(((({{{.....}}}}||}||||,...........,|,|{{{{{|||,},,|||,||||||,}|||,,.||,.....,})}))))})))})))}}})|}}.....,,,}|},..||||||{,,,{,((((((((,{{.((((((((((((((({....,,.....(((....................)))...},...))))))))).....))))))).....,,,,,(({((,,,,,...,,,.,,,|}}}}(((((({{{((((((((...........))))))))...{((((((.........))))))),,....,,......}}}.,))))))........,....|,|}||,,..,,,)})))))},,.|}}}}}}},,}}}}|}}|||,,,..,,,|||||,{||.||,,..||{|{{{,,{,,||||,,,||}|||||||,,,.|}}}}||||,...,}}||}}}}}}|}},,,,,,,...})))))))))..,{{{{((((,(((({{...,,{{,{,..((((((((((.{{.(((((((.,,{({{,,,....,.|||}},,|||{|||{{.,,....,,.({..({...((((((((...((((((({...})))))))...))))))))...})..}}(((((..(((((((((.........)))},)))))(((((((((....)))))))))...{{{....}},)))))...................(((((((((((((..((.((((((((((((((,...})))),,.,})}}},))))).))..))....)))))))))))}}}}........((((((......)))))).............,}}}}.))))))),},)))))))))).....{{{....)})....}}))}}..})))))))|((((.((((.((....,).)))).)))),.}}}},})}}}}}},},,))}||{{{{{,{,.{((((((.....)))))}}.)){((.((((..{(((.......)))})))).))}}}}|}||.((((((.....)))))),,,...}))))))))))))).(((((((((((...))))))).,,,.,|||||((((..{{(((......(((..,,(({.,..,,|||},|,...}}}......})))}}))).|.......,,,,.))))}}}},,.,}}}.}.))).))))).}))).....)).))))))}},.,,..,.......))))),.))))))))))))|,||,||||}}},}|}}|||}}.,,))}}))}).))),)||||((.{((((.((((....)))).)))))))}}}{{{{{({,(((((((({........(((((((...))))))).....((((.((((((,....))).))))))).((((((((((((.(((....{({(((..........},)))))..))))))))))))))).(((((........))))).........{((((....))))).....{(((((((((((((((((...........))))).)))}},,)))))))))))))))}..{{,((((((((((((((((({(((((,,,,,,{{{{{{{{{((((,.,,|||}{{.,|||}}||||{,,,,,,{{,,{,{{{{{((,,,...{,,|||||||{{{{{,,.,{{{(((((..,((({.(,,{,{{..,.{{{{{({(((((({,{{({{{{{{{|||..||||{..,,,......))))),,}}.....{{{{{{{{...(((((((((({(({{{,..,{{{,......,.,}}))))}.,,.})))))))))..........))))}|||,,.,,,.{{.((((((((((((((((.(((((.,((,..{{,......,})})..{||...(((((((((((.....((((....)))).......)))))).))))).,}}}((((((.(((((..(((((..((((((.{.(((((((......,{{,....,,,,.......))}))))}}.....{{.....,,.)))))))))))..))))).)))))),..(((((..((((({....,{{,(((,{.{{.......,,))})},,,.}...}}}})),,...))))).........))))).))))))))..)))))))),||{.,{,,.....,,}.}}}||,|||||||.||||,||.|||||.,,,}},,,,,.......,,,|{|{{({(({{{{,....|||...,}}...|||||,||,,...{{{{|{....)))))).,,,(((((..,,,....,...{,.{{{{{,.({{{..,,,|||}{||}|}.,,,},},),)},,.)))},...((((....))))....||||},,,}.,}))),.}))}))))))))},},}|,,,||}||.,.||{,.{((((.{{{.{,.......},.}}}.)))))}}}....|},,,,}}}.{{{{{.......))))}..,,.)))))))))))})}}}})|{{|||,,..,,,.|||}|,((((((((.........))))))))...)))}}}}}}}..}}}))),}))).{{{{{{...{|{{{{{.,,,.||||.||.{{{|,,,.))))}},,)))),.})))))))..})))))..}})}))))}}}}}}))))))}}},}))}}|,||||||||}||||,.,,}}}},|||||,|,,....{((((........))))).,,,,,.))))))))))))))),.{{{{|{.....,,,,,,,.....)))))).....}))))))).)},,|}}}|||.,,||,.,,|,..(((((((........)))))))||}}}|)||}}||||,,||,|||}|||||,}}}}|,|||{{{{{{|||||,.|||||,,,}}}}}}}}))})|)}.}|}||||}}||||}}},},)}}},|{{{((((((((,{{(({.(({,.{{((((....))))))}}.}(((((.,((((,,(((((...,,||...,,,,.,{(((({{........)))}}}})))))))))).,..)))))(((((((..(((((((..(((..,........))).)))))))))))))).{{{{{{....)))))).((({...,........,.}},}))),,.((((((((.(((.............))).)))))))).||||||,,,.}}..,,,((((((((...((((((((..(((((.{..(((.,.(((((.(((..((((.((..((.(((((((((((((((((,,,{{,,{((((((,,,({..({(((({{{{...,..}))}}||,||}..}}{{{{||.,,|,,..|||||{,||||}...(((..,,||}.,|,{||||})}||||,,{{|||{.,|||||{|||{{.,|.,)))))..,}..}))}})}...))}}}}....}}},...}||||},..,.............)))))))))(((({{.,,......)))))).((((((((.{{((((((((((......)))))}))))).)).))))))))((((((.(((((.,....})))))..))))))............)),}))))).....})..))..)))).,.))).))))),.)))...,.))))).))).))))).....)))))))).}}}).)))))))).))}}..|,||||,|.}),),,}))}|}}))}},))},}}})),)))),))}}}}}|,,..{,{(((,(({{{{{(({{{..{{|||||{{{{||..|||||||,{((({{{{(((((.((((((,,.{(((.,,,,.,}},||||.,,,,.}))},...((((((.......))))))..},(((((((((((,({..(((((((((.....((((((((.....,{..((((.........))))..|,.....}))))))))....)))))}}))).}}}.....,({{{,,,,,,{....})))}...{{((((.(((....))).)))))),{((((..(((((((((.((((.(((...))).))))...)))))))))...))))|,.......,,.,,.)))))))))))...)))))).))))},,,}..}.||||,|..((((((........)))))),}))),)})}}))),....}}}}},,))))))),}.,|||..|}}},.||||))))}}}}}},|||{..,,)))),.}})))..,)}.)))).))..)))))))),.}})))))))))))),...))))))))...||,,{..((((((..,,,.,,||,.,((((,(||{.,,...,,,,,,,}.||||,}},,,|}}}.,,})}))}}..}))))))))),))},.(((.(((((((.(({..{{{(((((.((.(((((((.,(({(({...,,..,}}}{{,,{{{((........))).)))}}..((((((((.((((((({.(((((({((,,...}}||{((((,(((....})),))})}..,....,..|||{{{,{{.(((((.(.((((((.....)))))).).)))))...((((((((..,,,{{.{,{{,...})))},......{{....}}...,,......))))))))..........}}||||...((((({.(((......))).})))))..}}}}})))))}))))))).))).))))).,{{||.{((|{((({{.{{{.........))).}))))}},,.,}))).))..))))))))).)))))...}}|,,((((.((((....((((((((((((........))))))))))))..))))))))..,,,))).))))))).)))....)))))))......)))))))..(((((((.(((((((((..,,,.{,,(({({(({,,,,|||{,,.}||||||,(((((....))))}.||,..,,,,.....}||,......(((({{{..,,,..)))))}),,}}}}}|||}(((((((..(((((....)))))..)).)))))........))))))))))))))))..(((((..(((((((((((((((((.,{(({.{{(.{((,,((((((......)))))).))).}}}.,,,}}).))))}.,)))))))....)))},)....)))))..

Transcripts

ID Sequence Length GC content
GUCUGAUUACCUGCUCCGCGAGGCCGCGGACACGUGCGGAGAGCCGACU… 11663 nt 0.3970
ACUGCGUCCCGCGCCGCUCGCUCAUCCCCGAGGGGCCCCUGCAACCUCU… 11654 nt 0.3964
Summary

The protein encoded by this gene is a member of the CMGC family of serine/threonine protein kinases. This kinase is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression and G1/S transition. The activity of this kinase first appears in mid-G1 phase, which is controlled by the regulatory subunits including D-type cyclins and members of INK4 family of CDK inhibitors. This kinase, as well as CDK4, has been shown to phosphorylate, and thus regulate the activity of, tumor suppressor protein Rb. Altered expression of this gene has been observed in multiple human cancers. A mutation in this gene resulting in reduced cell proliferation, and impaired cell motility and polarity, and has been identified in patients with primary microcephaly. [provided by RefSeq, Aug 2017] CIViC Summary for CDK6 Gene CDK6, along with its partner CDK4, are key players in cell cycle progression. The complex has been implicated in a number of cancer types, and is the focus of therapeutic research and development. One targeted therapy for CDK inhibition is palbociclib, which may slow the growth of advanced stage breast cancers. It has also been shown, in mouse, that CDK inhibition may sensitize mutant PIK3CA tumors to PI3K inhibitors.

Forensic Context

A study in humans demonstrated that the CDK6 was upregulated in the plasma of coronary artery disease patients and showed significant predictive value with an AUC of 0.59 in ROC analysis [Abdallah et al. DOI:10.1007/s40291-022-00622-1].