| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUGGAGGCGGAAGUGGCGCGGCCGCGGAGGGGCCUGGAGUGCGGCGGCG… | 2483 nt | 0.5509 |
The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. This protein forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein in AIDS. [provided by RefSeq, Jul 2008] CIViC Summary for CDK9 Gene
A study in mice demonstrated that cyclin-dependent kinase 9 (Cdk9) expression is increased in the infarct region of cardiac tissue following acute myocardial infarction, and its knockdown in cardiomyocytes promotes cell survival, ATP production, and mitochondrial membrane potential stability under hypoxic conditions [Xue et al. DOI:10.1161/JAHA.122.026160]. The CDK9 was identified as a direct target of the cardioprotective microRNA miR-483-3p, with its downregulation being a key mechanism through which therapeutic hypothermia exerts its beneficial effects.