Basic Information

Symbol
CDKN1B
RNA class
mRNA
Alias
Cyclin Dependent Kinase Inhibitor 1B KIP1 P27KIP1 Cyclin-Dependent Kinase Inhibitor 1B (P27, Kip1) Cyclin-Dependent Kinase Inhibitor 1B Cyclin-Dependent Kinase Inhibitor P27 P27Kip1 CDKN4 MEN1B MEN4 P27
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_004064.5
Sequence length
2411.0 nt
GC content
0.4591

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-772.40 kcal/mol
Thermodynamic ensemble
Free energy: -821.57 kcal/mol
Frequency: 0.0000
Diversity: 645.65
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........(((..(((((.....(((......))).........)))))(((((((((((((((((.(.....).))))......(((((((((..((((((.(((((.((((((((....)))...)).))).))))).).)))))..)))))..(((.(((((((..((((.((......)).))))............(((((((((((((((..((..(((.(((((((.(((((((...(((.....)))...))))).))...)))))((((((.(((((((((..((.((((((((((((((((....(((((((((((((((.((((((((..........)))))))).)..))))))..)))..)))))..)))....))).))))))))))))(((((....(((((..........)))))...)))))..(((((.((((((.(((.(........)..)))....)))))).)))))...))))))))).)))))))).))).))..))))))))))))))).....))))))).))).((((((...(.((((((((((((..(((........)))...))))).).)))))).)..)))))).))))..)))))))))))))....(((((((..((((.((...(((...............(((((......(((((((.((((((..((((((((((...))))).(((((..((.(((.(((((.(.(((((((.((((((((((.(((((((....((((((...(((.((.(((((((((.(((((...))))).))(((((((.(((((.........(((((((.((.((((((((.(((.((.....((((.(((((((....)).)))))((((.(((......)))(((((.............)))))))))((((.(((((((..((..................))..)))))))..))))))))..)).))))))))))).((((((.(((.((....))))))).)))))).)))))))..((((...))))....))))).))))))).((((.((((((((((((((((.((......)).)))))).)))))))))))))).........................))))))).)).)))........))))))....)))))............................)).))))))).)))..(((((((((.(((((.....))))).)))).)))))((((.((((......)))).)))).....(((((.......))))).........((((((((((...)))))))....)))...))).)))).).).))))))))))))))(((.(((.(.((((((........(((((((..((((..((((((((((....)))).)))))).))))..)))))))...((((((.((((((...(((((((.((((((((.((..((((.((...)).))))..(((....)))..........(((........))).(((..(((((((((((.......)))))))))..((((.....))))....(((((((((....)))))))))((((((((((......))))))))))))..))))).)))))))))))))))...)))))).)))))).)))))).)))))))...........(((......)))((((((.....((((((.((((......((((((((.((((((.......)))))).))))))))((((((........)))))).))))))))))............))))))......)))))..)))))).)))).)))(((((((....)))))))...............)))))((((((((((((((..((((((((((((...(((((((((((...)))))))))))...))).))))).((((((((((((((((((...(((((.((((((...((....)).....))))))))))).))))).))))).....)))))))).)))))))))))).)))))).......)))...)).))))..)))))))..((((((....)))))).....(((....)))..(((((((((((((...(((((((...(((((((.....((((.((((..(((((((((.((((...)))).))).....(((((....))))).))))))..)))).))))........))))))).)))))))..(((((((((..........))))....)))))))))))))))))).((((((((((.((.(((....))).)).))))))))))(((..((......))..)))......))).
Thermodynamic Ensemble Prediction
..,,,,.,.,((({,({{({.,,..(((,..,,,}}|..,......,||||(((((((((((((((((.(.....}.}))),...,.,((((((((..((((((.(((((.(({(((((...,|}}...))}}}).))))).).)))))..))))),,(((.(((((((..((((.((......)).))))....,,......(((((((((((((((..((..(((.(((((((.(((((((.,.(((.....)))...))))).))...)))))((((((.(((((((((,,((.(((((((((((((({,.,,,(((((((((((((((.((((((((..........)))))))).),.})))))..))),.}})}).,})),..}))),))))))))))||{{{.(((({(.{{.{((({......}}}}}.,)))))},||||{,((,{||.}}|}||,.,,,..,,,|||....}}}})}.}})))..,))))))))).)))))))).))).))..))))))))))))))).....))))))).))).((((((...,.((((((((((((,.(((,.....,.))).,}))))).)},))))).,..)))))).},,,.,))))))))))))).,.,{{{((((..{(((,((,,.,,|}},,......,,...{{|||......{((((({.{(((((,,((({{(((((...})))).{(((({.{{.(((.(((((.(.(((((((.,{((((((({.,||||||,.|,((((((,..(((,((.(((((((((.(((((...))))).)){((((((.(((((....,....(((((((.(,.((((((((.((({(,...,.(((({(((((((....)).)))))}}}}}|{({,{,,.,,|({{((.....,....,..)))))..))|,||.{((((((.,((.........,,,......}}..))))))}..)))))}.,..))}))})))))))).((((((.(((.((....)))))))})})),).)))))))..((((...))))....))))).))))))}.,((({((((((((((((((((.,.......}}.))))))))))))))))})))),..,,....................))))))).)).))}..,,,.,.)))))}....}}}}|{...........................}},)))))}},|,,..{((({((((.(((({.....))))).)))).))))}((((.{(((.....}))}).)))).....|||,|,.,.|||))|||,,,......{{,{((((({...))))))}...,))),,,))).)))).).).)))))))}))))))(((.{((.(.((((({.,.,{{,.(((((((..((({..((((((((({....}))),}))))).))))..))))))).,,{(((((.((((((...(((((((.((((((((.((..((((.{{...|).)))}..{{{....})},,........,{,........}}}.(((..(((((((((((.......)))))))))..((((.....))))....(((((((((....)))))))))((((((((((......))))))))))))..))))).)))))))))))))))...)))))).)))))}.)))))),)))))))........,,{(((......))}|{|,,,.,...((((({,((((.{..{(((((((((.((((((.......)))))).))))))))})|,{{........}}},,).)))))))))).....,,|,{{({....,,}},,.}}}})..}))))}.})))}}}}(((((((....)))))))...............}}}}}|{{{{{{(((((((,.,(((((((((((...(((((((((((...)))))))))))...))).))))).((({((((((((((((((...(((((.((((((...({....}).,...)))))}))))).))))).))))))},,..})))))}.}}}))))))))|.}||}}|.,..||,}}}.,.}|,))}}..))))})),,||{{{{....}}}}}}.....|||....}}},.((((((((((((({{{........}}||,,((({{......})}}},.{(((.,.(((.((({...}))).))).}))}(((({....))))).,}|}}|{{}|||{.,,,.,,,,}))},}}}}},,.,,})},,|((((((((..........))))|...,)))}))))))))))))}.((((((((((.,{.(((....))).}}.)))))))))),,,..,,....,,)),.,,},,,...}},.

Transcripts

ID Sequence Length GC content
CUUCUUCGUCAGCCUCCCUUCCACCGCCAUAUUGGGCCACUAAAAAAAG… 2411 nt 0.4591
Summary

This gene encodes a cyclin-dependent kinase inhibitor, which shares a limited similarity with CDK inhibitor CDKN1A/p21. The encoded protein binds to and prevents the activation of cyclin E-CDK2 or cyclin D-CDK4 complexes, and thus controls the cell cycle progression at G1. The degradation of this protein, which is triggered by its CDK dependent phosphorylation and subsequent ubiquitination by SCF complexes, is required for the cellular transition from quiescence to the proliferative state. Mutations in this gene are associated with multiple endocrine neoplasia type IV (MEN4). [provided by RefSeq, Apr 2014] CIViC Summary for CDKN1B Gene

Forensic Context

A review of temperature-dependent RNA metabolism noted that in mice and other species, the translation of the CDKN1B mRNA is enhanced at lower temperatures through binding by the cold-inducible RNA-binding protein CIRBP, which affects its stability and translation to reduce cell division [Becskei & Rahaman DOI:10.1016/j.csbj.2022.08.008].