| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCAGUCAGGAGGCCGUGCAGUCCGAGAUGGGCUCGUCUCGGGCACCCU… | 2555 nt | 0.5648 |
This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6. [provided by RefSeq, Dec 2014]
A study in humans demonstrated that the CDSN mRNA is a highly specific and sensitive marker for skin, as it was detected in samplings from hands, feet, back, and lips but not from tongue, and it successfully generated profiles from aged skin traces stored for up to 12 years [Lindenbergh et al. DOI:10.1016/J.Fsigen.2012.01.009]. Another human study confirmed its utility for inferring the skin origin of touched contact traces, as it was detected in all skin swabs and in most mock casework samples like mobile phones and keyboards, showing significantly higher expression in skin and sweat compared to other body fluids like vaginal fluid [Akutsu et al. DOI:10.1016/j.legalmed.2018.05.003]. A review further notes that the CDSN is significantly overexpressed in skin tissue and is detectable in forensic samples such as thumbprints, supporting its application for skin cell identification [Nanny Wenzlow et al. DOI:10.1177/10406387231153930].