Basic Information

Symbol
CDSN
RNA class
mRNA
Alias
Corneodesmosin S Protein D6S586E Differentiated Keratinocyte S Protein HTSS1 HYPT2 HTSS PSS1 PSS
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_001264.5
Sequence length
2555.0 nt
GC content
0.5648

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-883.90 kcal/mol
Thermodynamic ensemble
Free energy: -927.96 kcal/mol
Frequency: 0.0000
Diversity: 675.78
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((.((((((..((((...((((((((....))))))))))))(((((((((((((.(((((.((((..((((...(((..(((((((((((((((..(((.((((.((((((.((((....((((...((..((((..(((....))).))))..)).((((......((.(..((....(((((.......(((((((((((...(((.(((((...(((.((.....((((...(((((..((((.(((((((((.(((.(((((((...))))))).)))....))))).)))))))).((((((.(((..(((......)))..))).))))))....(((((((..(((((....................)))))..)))))))...........((.((.....)).))((((((...((((((....)))))).)).))))...(((.(.(((((((..((((((.((.((((......)))).)).((.((.(((........))).)).)).)))))).))).)))).).))))))))..))))......).).)))...)))))))).......))))))))))).((((...(((........))).))))......)))))....))..).)).....))))..))))...)))).)))))))))).((((......))))(((((((....).)))))).((((((.(..((.(((.((((((((((....(((........))))))..))))))).)))))..))))))).(((((.(((.(((...((((((((.((((((((((((((((((((((...((((.(((...(((.((((...))))..)))..(((.((((.(((((((.((((....(((....)))..))))))))))))))).)))........(((....)))))).))))...)))))......((((((.....)))))).))))))))).......((((...(((.....)))))))))))))))....(((((((..((((((((((........).))))..........))))).((((((((((((((((((....))).........(((............)))..)))))).)))))))))..(((.((((((((....))))))))))).)))))))..(((((....(((........))).....)))))....((((((.((.((((....(((.......)))....)))))).))))))..)))))))).))).))))))))))).)))))).....)))))))))..)))..))))...(((((((....((((.......(((....))).(((((.((((.....)))).....)))))..(((((((........))))..)))((((((((.....)))...)))))...))))....))))))).((((.......))))((((((...))))))..).)))))))))))))))))))))........((((.((........)).))))...((((((((((((((....(((((((......))))))).(((.(((((((..((.....))..))))))).))).....((((((.((((((..............(((...((((....))))..)))...)))))))))))))))))))))).))))..))))))......(((((.((.(((((..(((...........)))..))))).)).))))).......(((((((((...............((((((....((((...((....))........((((((..................)))))).....((((((((.((((((((..............((((..(((((.....)))))..)))).........((((.(((((....)))))....))))...((((((((((.((((..(((.((..((((((..................(((((.....))))).((((((...(((.....)))...((((((.......))))))............(((((((((..(((((....(((((((((((((....((((..........................)))).......))))(((..((((...(((((((...........((((....))))..........(((.(.....).)))...(((((((...((((((........)))))))))))))....))))).))...(((.((....((((((...))))))..)))))))))..))).)).))))...)))....))))))))))))))..))))))....)))))))).)))..))))...))))))))))..)))))))).))).....(((.....((((.....(((.....)))...)))).....)))))))).))))....))))))......(((......)))))))))))).((((((....)))))).))))).....
Thermodynamic Ensemble Prediction
.(((((.((((((.,(((..((((((((((....)))))))))).,{(((((((((({(,({(((,(((,..((((...(((..(((((((((((((((,,((,.(((,{((((((.((((....((((..{(({.((((..{{{..,.||}.}}}},,||{{{{(,,....,,....,....,{,,,,.,,,...(((((((((((...(((.(((((...(((.((,,..,((((.,,(((((,,((((,(((({{{{,.{{{.|||||||...))))))).)))....})))).))))}}}}.((((((.(((..(((......)))..))).))))))....(((((((,.(((((.....,,,{,...,,,...,},}}),,})))))}.,.,......,||.{{.,}|,}},}}{((({{.,,((((((....)))))),}}.)))}...{((.{,(((({{{..((((((.((.((((,.....)))}.)).{{.{{.{{{........))},)).)).)))))).))).)))).},))))))))..)))}.,....}.}.)))...)))))))).......))))))))))).{{||..,{((........,,,.}})),...,})))))..,.,),,),)),....),))},))))...)))).)))))))))).((((......))))(((((({....}.)))))).((((((.(..((.(((.((((((({{(,...{((........}})}))..))))))).)))))..))))))),(((((.(((.(((...((((((((.{{{{{(((((((((((((((((...((((.(((...((({(({{..,|||,.,|||..{,{.(((,{(((((((.((((.{..,,(,...))),,))))))))))))))).)))}..,,,},,{|}}}})}}))).))))...)))))......((((((.....)))))).)))))))))}}}.....((({.,{{{.....})),})))}}}||||{{{{(,,...,..(((((((((,.,......).))))..........))))).((((((((((((((((((....))).{,,.....|||...,|,......)),..)))))).)))))))))..(((.((((((((....)))))))))))..))))))}}|{(((....(((........))).....)))))....((((((.((.((((....(((.......)))....)))))).))))))..)))))))).))).))))))))))).)))))).....)))))))))..)))..))))...(((((((,...,,,........(((....))).(((((.((((.....)))).....)))))..(((((((........))))..))),{((((((,,{..|||,..|,}}}...,},,....}}|||||.((((.......)))),|||||.,.|||||}...,||||}}}}}}}}}))}}}))),,...,.,||{{.{{.|.,,,}.)),)))),,,{(((((((((((((....{((((((......))))))},{((.(((((((..{{.....}}..))))))).)}|...,,,(((({{((((((......,....,.,{{{...((((....))))..}}}...)))))))))))))))))))))).)))}..,},,,,......(((((.((.(((((..,,,,,.........,))..))))).)).))))).......,,,,,,.{{,,,,,,,,,..{{((((((((.((((,{.....,,.)))).)}}...,,}}}}}}}......((((((((,{((((((...........,........................})))))))))}}})))....,,(((,,.{{{,,...,,,{.,{|||,...|||}}...,}}}}...(({{((((((.{{{|,,{{{.{,.(({((((......}}}}.}},,...,{{{,.....,}}}|{{{{{{{...,,,.....,||,,.((((((.......})))))...,,,,...{,({{{{{|||..{{{{{......|||||||||(({.{,|.||,....|||},,,,,,.,,,,,,,.,}),|,....,,,}.}}|||,.{{,,...{{{{{{....,,,,,,..((((....}))).......,.,(((,{.....|,||}...{((((((,..{(((((........))))))))))))),,.,|||||},,,|||||{{|..,,((((((...)))))},,,|||||}||,,}}}|||.,}}},,.))...,,))})))))))))})},)}}},..,}},,,,,.)),)})..)))),..)))))))))}.,)))))}}),|||,,,,..,{{{...{|||.,.,,{{|..,,,}.............((({{{(((.{...............,)))))))).....))))))))))),((((({....)))))).))))).....

Transcripts

ID Sequence Length GC content
AUCAGUCAGGAGGCCGUGCAGUCCGAGAUGGGCUCGUCUCGGGCACCCU… 2555 nt 0.5648
Summary

This gene encodes a protein found in corneodesmosomes, which localize to human epidermis and other cornified squamous epithelia. The encoded protein undergoes a series of cleavages during corneocyte maturation. This gene is highly polymorphic in human populations, and variation has been associated with skin diseases such as psoriasis, hypotrichosis and peeling skin syndrome. The gene is located in the major histocompatibility complex (MHC) class I region on chromosome 6. [provided by RefSeq, Dec 2014]

Forensic Context

A study in humans demonstrated that the CDSN mRNA is a highly specific and sensitive marker for skin, as it was detected in samplings from hands, feet, back, and lips but not from tongue, and it successfully generated profiles from aged skin traces stored for up to 12 years [Lindenbergh et al. DOI:10.1016/J.Fsigen.2012.01.009]. Another human study confirmed its utility for inferring the skin origin of touched contact traces, as it was detected in all skin swabs and in most mock casework samples like mobile phones and keyboards, showing significantly higher expression in skin and sweat compared to other body fluids like vaginal fluid [Akutsu et al. DOI:10.1016/j.legalmed.2018.05.003]. A review further notes that the CDSN is significantly overexpressed in skin tissue and is detectable in forensic samples such as thumbprints, supporting its application for skin cell identification [Nanny Wenzlow et al. DOI:10.1177/10406387231153930].