Basic Information

Symbol
CEACAM6
RNA class
mRNA
Alias
CEA Cell Adhesion Molecule 6 NCA-50/90 CD66c NCA Carcinoembryonic Antigen-Related Cell Adhesion Molecule 6 (Non-Specific Cross Reacting Antigen) Carcinoembryonic Antigen Related Cell Adhesion Molecule 6 Cell Adhesion Molecule CEACAM6 Normal Cross-Reacting Antigen Carcinoembryonic Antigen-Related Cell Adhesion Molecule 6 Non-Specific Crossreacting Antigen Cluster Of Differentiation 66c CD66c Antigen CEAL
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002483.7
Sequence length
2594.0 nt
GC content
0.4588

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-698.80 kcal/mol
Thermodynamic ensemble
Free energy: -747.44 kcal/mol
Frequency: 0.0000
Diversity: 687.34
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((((((((((.(((.((((((.....((((.(((.((((((.(((..(((((((.(((((....))))).(((((..((((.((((((.((..((..(((((((...(((....))).......(((..((..((((((........((((((((((..(((....))))))).))))))......((((((...((((.....((((((...((((((((((.......)))))))((.((((..(((..(((((.........(((((....(((.((.....((((.....))))...)).))).....)))))..(((((((.(((..........(((((((.((((........................(((((...((((...((((((....)))....)))....))))..)))))..(((((.(...((((.......)))).).))))).)))).))))))).((((((.(......)))))))..............((.(((((((..........))))))).))..))).)))).))).................((((((((((((.((((((((((((((....(((...(((.(((((((.((.((..(((((((...)))))))...)).)).)))))))..))))))....)))))))))).))))..(((.....((....((((((((.((.(((((.........)))))..))...)).))..))))....))....)))(((.((....))))).(((((...)))))......))))))))))))..(((((..........(((((((......((.......)).....))))))))))))........((((...)))))))))..)))..)))))))))...)))))).......))))..))))))))))))..))...)))...............((((.(((((......(.((.((((((.((.((((.((..........))...))))..)))))))))).)..))))).))))....)))))))...))..))))))))))))...))))).....((((......)))).)))))))))).)))))).))).))))......)))))).))).))))).....((((((....(((((......).))))..)))))))))))))(((((((((....((((........)))).(((...........)))......((((((((((((((........))....((((((..........(((.((((((......((((((..((((((.(.((.....)).).))))))))).....))).((((...))))....((((((((.(((.........))).))))))))..((((((...((.((((................)))).))..))))))......)))))).)))))))))..((((((.((((((..........)))))))))).)).........((((((....))))))))))))).)))))..((((((((((((((((....((((((......................))))))......(((((.(((...))))))))........((((.((.((((((....)))))).))))))..((.(((((...........))))).)).(((((((.....(((.(((((((((...........((((...(((((.............))))).........))))))))))))))))...))).))))))))))))))..))))))....(((..((((((((((((...(((..((((((((.(((.(..........).))).)))))))).....)))...))))(((((.((..(((((((...((((((((((((..((((.((((((((.((((.(.(((((((.(((((((((((..((..((.((((..((((((((....)))(((((((((..((((.((((((....((...........)).(.(((((((((((((.....)).))))).......)))))).)............))))))))))..))))))).))..........((((...((........))...))))))))))))).))..))...)))))))..)))).))))....)))).)))))))))))).(((((.((((....).))).)))))))))....)))))))))))).)))))))..)).)))))...........(((((......)))))...........(((((.((((((...(((.(((((((.((((((((....(((((((......((((((............))))))......)))..))))))))))))))).............))))..)))))))))))))).......(((((((.....))).)))))))))))))))..)))))))))..........(((((((((......(((((.(((...........))).)))))......))))))))).....
Thermodynamic Ensemble Prediction
.{((((((((((({.{({.((((((.....{{{{.{{{.||||||.{{...{{{||||,(((((....))))).{{.....|{((.((((({.{{..{{.{((({((,...(((.,...,},,,|,...}}.}})}.|,|||,.,}}}}},((((((((((,.{((....))))))).)))))).,,,,|||(({{...{(((....,((((((...{(((((((((.......))))))}|{.(({{.,(((..(({(({,,......{((((....{{(,({.,|,.,,,,{,,,||||,...)),))),,...)))))..{{{||||,{{{..,,,,....||||{||,|,,{|,,||||.........,{{,.{{,({(((,..((((,,,((((((....}}}....,}}....}}||..}}})),.((({{.{...((({.......}))).,.))})}.,}}}.)))}}}},{{{{,,,(,,,,,,}}||}||,,,,.,,,,{....((.(((((((..........))))))),)}..}}}.||||{|||,,{,,............((((((((((((.((((((((((((((....(((...(((.(((((((.({.({..(((((((...)))))))...)).)).)))))))..))))))....)))))))))).)))).,{(,,..},|{....,,.,,....{{,{((((,..{{{{.{,,,,,.,}.}}}}.}},.,})},....,},......(((.((....))))).(((((...)))))..,...))))))))))))..,,((({{{{{.....{(({(((,,....((.......))....,)))))}}}},||{{{{....,(((...||||,,,,,..}}}..)))).,,)),..}}}))),,.....}))),,)))}|||||,||...,,,.({{{.{{{..........{{{(,(((((......(.((.((((((.{(.((((.((..........))...))))..}})))))))).}..)}}}}.)))),,,,)),,}))},}),}}))})))}}}}}}.,,||||{{{..,|,||}}....}},,,)))})))))),||||||.|||.}}}}..,,,.)))))),)}}.}}}}}.,...((((((..{.({(((,,,.,,|,}}}|..}}}|}}.,,}))|{|{|{{|||,.,.((((........)))).{{{...........))).,}},.{{||||||||{{,,....,}}}))}||}|||{,..........,{{{.{{((((....,||{{(({..((((((.(.((.....)).).)))))}}}}..,,.},|.((({...})))....((((((((.(((.........))).))))))))..((({{{...{{.(({({{.......}},....}}}}.|},.||||}}......}}}}},.}}}}})})),}|{||||,((((((..........))))))}}||,||||}}.,}}}|{{(((....))))),)))))}),))))}..((((({((((((((((,,..,,,{{{..........,,,,........,,.|||{{{.{{((((({{(,...}}},}}),}}}}}}.}},||}||,{(((((....)))))}.,,,|||{{((.(((((...........))))).}},((((({{..|..(((.(((((((((...........((((...(((((...........,.))))).........)))))))))))))))).},))),))}})))))))))}.,))))))..,,|||..,{{{{{{{|||{...{|{|.((((((((.(((.{..........}.))).))))))))....}))).,.})}}{((((.((..(((((((...((((((((((((..((((.(((((((,{((((.(.(((((((.((((((((({{.....(({.((((...}}}|,||}...,,|(((((((((..{,{(.((((((...,({......,,,..},.,.(((((((((((((.....)),,)))).......)))))).,.........,,.)))))))),)..))))))).),...{{{,...{{||,,.||......,{||{..,,)).)))...}},,...||,,.}}})))).,)))).))))....))}).)))))))))))).(((((.((((....}.))).)))))})))....)))))))))))).)))))))..)).)))))............,,{{........}}}..........(((((({(((((({....|,,{(((((.((((((((....(((((((......((((((............))))))....}.)))..))))))))))))))).))}...,,}}}}|}||||}||||}}.|||}},}}},,,)))}.,},,,,,})))}))}}})))))},)))}.))))))))),....,,,..{((((((((,,|...(((((.{{{...........}}}.)))))......))))))))}.....

Transcripts

ID Sequence Length GC content
ACAGAAGGAGGAAGGACAGCAGGGCCAACAGUCACAGCAGCCCUGACCA… 2594 nt 0.4588
Summary

This gene encodes a protein that belongs to the carcinoembryonic antigen (CEA) family whose members are glycosyl phosphatidyl inositol (GPI) anchored cell surface glycoproteins. Members of this family play a role in cell adhesion and are widely used as tumor markers in serum immunoassay determinations of carcinoma. This gene affects the sensitivity of tumor cells to adenovirus infection. The protein encoded by this gene acts as a receptor for adherent-invasive E. coli adhesion to the surface of ileal epithelial cells in patients with Crohn's disease. This gene is clustered with genes and pseudogenes of the cell adhesion molecules subgroup of the CEA family on chromosome 19. [provided by RefSeq, Apr 2014]

Forensic Context

A study in human burn patients identified the CEACAM6 as one of 19 center genes that were consistently differentially expressed in blood across early-stage, middle-stage, and between-stage comparisons following injury, indicating its role as an RNA marker associated with burn injury progression [Wu et al. DOI:10.007/s10753-018-0829-0].