| ID | Sequence | Length | GC content |
|---|---|---|---|
| UCCCAAUCCCGGGGCGGCCGGGCGGGGGUGGGCAGGGGGCGUGAGGCCG… | 2113 nt | 0.6720 | |
| UCCCAAUCCCGGGGCGGCCGGGCGGGGGUGGGCAGGGGGCGUGAGGCCG… | 2113 nt | 0.6720 | |
| AGCGAGUCAGAGCCGCGCACGGGACUGGGAAGGGGACCCACCCGAGGGU… | 1839 nt | 0.6623 |
This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. Activity of this protein is important in the regulation of genes involved in immune and inflammatory responses, among other processes. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with distinct biological functions. [provided by RefSeq, Oct 2013]
A study in humans identified the CEBPB as a transcription factor highly expressed in almost all cells and significantly up-regulated in blood samples from sepsis patients, confirming its role as a sepsis biomarker [Zhao et al. DOI:10.1016/j.imbio.2023.152763]. Another human study in acute myocardial infarction patients found the CEBPB was significantly expressed in NK cells from patients without plaque rupture, where it was involved in negative regulation of the immune system [Jun Qian et al. DOI:10.3389/fimmu.2022.908815]. A study in mice demonstrated that the CEBPB gene was upregulated in common in spleen leukocytes across three models of systemic inflammation (trauma/hemorrhage, burn injury, and LPS infusion) at 2 hours post-injury [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. In a separate murine model, the CEBPB gene was upregulated in skeletal muscle following both local and distant burn injuries, with expression observed at 6 hours, 1 day, and 3 days post-local burn and at 6 hours, 12 hours, and 2 days post-distant burn [Padfield et al. DOI:10.01.ta.0000230567.56797.6c].