Basic Information

Symbol
CEBPE
RNA class
mRNA
Alias
CCAAT Enhancer Binding Protein Epsilon CRP1 CCAAT/Enhancer Binding Protein (C/EBP), Epsilon CCAAT/Enhancer-Binding Protein Epsilon C/EBP Epsilon CCAAT/Enhancer Binding Protein Epsilon C/EBP-Epsilon IMD108 SGD1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_001805.4
Sequence length
1191.0 nt
GC content
0.6474

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-542.20 kcal/mol
Thermodynamic ensemble
Free energy: -559.98 kcal/mol
Frequency: 0.0000
Diversity: 197.52
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((((.((((...((((((..(((.((((((..((((.((((.((((.......(((((.((((((.(((((((.((((((((.(.((((((((((((.((((((....))))))(((.(((...((((.((((((((((.(((((((((..((..((((((((((.((((.(.(((.......))).).))))(((((((.....))))))).(((((((...(((((......))))).)))))))..)))))))).))..)).....)))))).)))..)))))))))).))))...))).)))....((.(((((.(..(((.....)))..).)))))..))((((((((((...))))))..)))).)))).....)))))))).)...)))))).)).)))))))...))......)))).))))).......)))).))))))))..)..(((((((((((((..((((..((.((((((.(((.(......)))).))))))))..))))..))....)))))((((((...((((((((..(((((((......))))))).......((((((((.((....))...))))))))......))..))).)))))))))..(((((.(((.(((((((..(((((((((((((((((((((..(((((..((((((((((......)))....((((..((((((.(((..........))).)))).))..))))......)))))))..)))))...))))))))...(((((...(((.(.(.((.........))).).)))...)))))(((....(((....)))....)))...))))).)))).))))))))).)).).)).)))))....))))))(((((......)))))..(((((......))))).....))))).)))..))))))))))..)))))))..(((.((...........)).))).(((((((((((...(((((((((((.(((.(.(((...))).).)))))))).))))))....)))).))))))).(((((((....(((....((((((.(.....(.((((......)))))..))))))))))......)))))))(((((((((.((......(((((......))))))).)))).)))))
Thermodynamic Ensemble Prediction
.,.(((((((.((((...((((((..(((.(((((,..((((.((((.((((.,.{,(.(.(((((((((.{(((((((.((((((((.(.((((((((((((.((((((....)))))),((,.(,,,,((((.{(((((((((.(((((((((..((..((((((((((.((((.(.(((.......))).).))))(((((((.....))))))).(((((((...(((((......))))).)))))))..)))))))).))..)).....)))))).)))..)))))))))}.)))){{{}}|{||{,.{,{..,{|||}|}}||{.}}}.,))},,,)),}}..||,(((((((((...))))))}.)))).)))).....)))))))).}...)))))).)).))))))),}.))))...))))).}.))).......)))).)))))))).,|.,(((((((((((((..((((..(,{((((((.(((.,......,))).)))))))}..))))..}}.,,.)))))((((((.,,(((({{,,..(((((((......)))))))......}|||(((((.((....))...)))))}||{.....}}..))).}))))))))..(((((.((,.(((((((..(((((((((((((((((((((..(((((..((((((((((......)))....((((..((((((.(((......,}..))).)))).))..))))......)))))))..)))))...))))))))...(((((...(((.{.(|({........,))).),)})...))))){{{....(((....)))....})}...))))).)))),,)))))))).)).,.)).)))))....)))))))||((......}})),}|(((((......))))).....))))).)))..))))))))))..)))))))..{((,((,..........}|,}||(((((.{(((((...(((((((((((.(((.(.(((...))).).)))))))).))))))....))))),.))))),|||((((,,,.(((....((((((.(.....(.((((......)))))..))))))))})......)))))),||||||{{{.{{,,....|||||,..,..||||||,.}))),))}}}

Transcripts

ID Sequence Length GC content
ACACAGGAGUGGGUGACAGAGGAGACUGCAGAGGGCAGGUCUAGGGCAG… 1191 nt 0.6474
Summary

The protein encoded by this gene is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-delta. The encoded protein may be essential for terminal differentiation and functional maturation of committed granulocyte progenitor cells. Mutations in this gene have been associated with Specific Granule Deficiency, a rare congenital disorder. Multiple variants of this gene have been described, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the CEBPE was significantly upregulated (2.959-fold increase) in lung tissue following hypothermia-induced death, identifying it as a candidate forensic biomarker for this condition [Takamiya et al. DOI:10.1016/J.Legalmed.2020.101789]. In human monozygotic twins, an integrative machine learning analysis found that higher methylation at a CpG site for the CEBPE gene was associated with heavier twins who reported less leisure time physical activity [Kibble et al. DOI:10.1098/rsos.200872].