| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACAGGAGUGGGUGACAGAGGAGACUGCAGAGGGCAGGUCUAGGGCAG… | 1191 nt | 0.6474 |
The protein encoded by this gene is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-delta. The encoded protein may be essential for terminal differentiation and functional maturation of committed granulocyte progenitor cells. Mutations in this gene have been associated with Specific Granule Deficiency, a rare congenital disorder. Multiple variants of this gene have been described, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the CEBPE was significantly upregulated (2.959-fold increase) in lung tissue following hypothermia-induced death, identifying it as a candidate forensic biomarker for this condition [Takamiya et al. DOI:10.1016/J.Legalmed.2020.101789]. In human monozygotic twins, an integrative machine learning analysis found that higher methylation at a CpG site for the CEBPE gene was associated with heavier twins who reported less leisure time physical activity [Kibble et al. DOI:10.1098/rsos.200872].