Basic Information

Symbol
CELF1
RNA class
mRNA
Alias
CUGBP Elav-Like Family Member 1 BRUNOL2 NAB50 CUGBP EDEN-BP CUG-BP HNab50 CUGBP1 NAPOR Embryo Deadenylation Element-Binding Protein Homolog Nuclear Polyadenylated RNA-Binding Protein, 50-KD 50 KDa Nuclear Polyadenylated RNA-Binding Protein Embryo Deadenylation Element Binding Protein CUG Triplet Repeat RNA-Binding Protein 1 CUG-BP- And ETR-3-Like Factor 1 RNA-Binding Protein BRUNOL-2 Deadenylation Factor CUG-BP CUG RNA-Binding Protein Bruno-Like Protein 2 EDEN-BP Homolog Bruno-Like 2 CUG Triplet Repeat, RNA-Binding Protein 1 CUG Triplet Repeat, RNA Binding Protein 1 CUGBP, Elav-Like Family Member 1 CUG-BP1 CELF-1
Location (GRCh38)
11:47465933-47565569
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_001376376.1
Sequence length
8132.0 nt
GC content
0.4760

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2705.50 kcal/mol
Thermodynamic ensemble
Free energy: -2860.31 kcal/mol
Frequency: 0.0000
Diversity: 2195.63
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.((((((.((....)).))).)))((.((((.((....))))))))......(.(((((......))))).)(((..(((.(((((....))))).).))..)))((.(((((((..((......)).))))))).)))))))).......((((((((((..((((((((((((((((((((((((((((..((....((((((((((((((((((((...(((((((((.......)))))))))...)))).......)))))))).....(((((((((((((((((((((((((....(((((......)))))....))).)))).))))))).)))...))))...))))..))))))))......))..)))))(((.....)))..(((...(.((((((((...)))))))).)...)))(((((((((...)))))))))((((...((..(((((((........(((((((((..((((.((.............(((((.....)))))..............)).))))....)))))))))(((........))))))))))..))...)))))))))))).......)))))))))............))))))..((((..........))))....((((((.((.((.......)).)))))))).((((((....)))))).((((........))))...(((((..(((.(((((......))))).)))((((((((.(((((((..(((((((((((((..(((((((((((((((((((((.((((.((((.(....((((((...))))))..).)))).)))).))...)))))))....((((((((((((.....(((((((..(((.....)))..))))))).(((((...(((((((((...................(((((..(((.((((((((((((.((.(((((((.((........)).)))))))))))))).....))))))).)))....)))))((...)).))).)))))).....)))))(((((((...(((...)))((.(((.(((..........))).))).))(((((.((((((.((((((((((.(((..(((..........(((((((((((((((((...))))))))))))).))))...(((.((((((((((................((((((......(((((((((((.(((((((.(((((((((.......(((......((((.....)))).........))).......))).)))))).)).)))))...)))).)).)))))......))))))((((((((((((((((((((((......)))))))..(((..(..(((((((((...((((.((((.(((((((.(((((((........))))).)).(((....(((((.........)))))....))).(((((((.....((((....)))).....)))))))..))))))).))))..))))...)))))).)))...)..)))..((((.(((((.....((((...)))).....))))).))))....((((((.........(((...(((((.((((((((((((....((((....))))..))))))(((((.((((....)))).)))))........)))))).)))))....)))..((((((((((((((((..((((.....)))))))))).)))..)))))))....)))))).....(((((...)))))...(((((((((..((((.((((((((((((...(((((((.((.....)))))))))....))))).))))))).))))............((.(.((((((......))))))).))...((.((..((((((((((((((((((((((((((((((..((..(((..(((.((......)).))).)))..))...))).)).)))).)))))))((((..(((((.((...)).)))))((((.((.((...(((((((.....((.((((((.((((..((((((((((((....))))...((((.(((...)))))))(.((((((........)))))))...((.((((.....))))))...))))))))...)))).)))))).)))))))))..)))).))))....))))((((((((.(((.(.((.((......))..))).)))..))))))))..))))))))).))))).)).)).((((((..(((...((((.(((((((..((.(((.(((((....(((......))).....))))).)))))((.((((((((.......)))).....)))).)).((((((((((((..........))))))))))))......(((((((((..((.(((((((((...))))))))).))..)))..))))))......(((..(((((...)))))..)))........(((.(....).))).......))))))))))))))..)))))).(((((((.(((((....((.(((((((...((((((.((((((((.....)))).))))................((((((.(((....(((((..((((((......))))))...)))))......)))))))))..((((((((.((.....)).))))))))...........)))))))))))))...)).....))))).)))))))..))))))))).)))))))))))))))))))))))))))).)))..))).))))).)).))).)))))))))))))))))).....))))))))).))).......))))))))))))((((.(..((.......)).).))))..(((((.(((((((((.(((.((.(((((((..(((((.((((.((((((((.((((((((...)))))))).((((((..(((((.(((((...(((((((.....))))))))))))....))).)))))))).....(((((.((((((.((......)))))))).....))))).......((((((.(.(((..(((.((...(((((........))))).)).)))..))).)..((.((((.....))))))((((((.((((((((((((.............))))))))))))..))))))))))))......)))))))))))).)))))((((((((((...((((.....))))....)))))(.((((((((...)))))))).)))))).........)))))))))((((.(((..(((((((((.....(........).....))))))))).))).))))......(((((((((((((((((((((.((.((.(((...))))).)))))))))..(.((((.((..((((...))))..)).)))).)...(((......)))..((((((.((((((..(((((((......((.((((((........))))))))..)))))))(((.......)))((((...((((((.((((...................((((((.....((.((((((((((.(..((((((..(((((.......((......(((((((.(((((((((((................................................................((((...(((((((((((((...(((((((...(((((((((...((((.....(((((((....)))))))..((((.(((((..((.((((((...............((((((((.((((((....((.........))....))))))))))))))((((((((((........))))))))))......(((((.((((((...(((.(((((((((.......((((.(((...))).))))......))))))))).)))...)))))).((.((((((....)))))).)))))))..((((((..(((((((((((((((.((........)).))))))(((.(((((((((((...(((((.((((((((((((((((((((.((((((.............(((((((((.(.((((((....(((..((.((((.(((((((....(((..(((((....((((.....))))..)))))(((.((..(((((((((((......(((((((.(((((.(((((((...))))))).)))))...)))))))))))).((((((....)))))).((((((...)))).)).(((((((.(((.((.((((((((.(((((((((((..(((....(.(((...((((((..((((((((.((((.(.((((((....)))))).).)))).))))(((........))).....))))..))))))...))))...)))..)))))))))(((((((((.((((.........))))((((((((....(((.......)))......((((((((..(((((.(((((((((...(.(((.(....(((.(((((..((((.(((..((((....)))).))).))))..((((.((((((((((.(.(((.((((.(((((.((((((((((.((((..............)))).......(((((((..(((.((.((((((.............(((((((.......((((.....))))...((((((.......)))))).))))))))))))))))))..)))))))((.(((((((((.(((....)))..)))).))))).)).))))))))))))))).)))).))).).)))))))...((((((..(((((((((((((((..(((......)))((((((..((((.(((((((...((((((.(((....(((.(...((((((...(((((..(((.((((......(((((((((((((.(((((....(((....................)))....))))).))))))....((.(((...))).)).(((((.............))))).....((((......(((((..((((.....))))..)))))))))(((((.((((..(((.(((....((....((((((.((...)).)).))))....))..))))))..)))))))))....((.((.((((((.........)))))).)).))..........................(((((((((....((.(((((.((.((((...))))...))))))).)).....)))))))))(((((((((......)))))))))........((((......))))...(((((((((.........)))))))))........(((((..........))))))))))))....(((.(((((....))))).)))....(((((....)))))..........(((((((((((((((((((.(.((.(((((((((((((((.........(((((((((((((((((.....((.((((..((.(((((.......((((((((((((....((.((((((((((.((((.((..(((.((...(..(((.................)))..)...)))))((((((............)))))).........((((((........((((........))))........................((...((((((((((...)))))))))).)).((.....))))))))....)).))))))))))............)))).))...))))))))))))..)))))))..)))).)).....))))))))))...)))))))........)))))))(((....))).........)))))))).))))))).............((((((.((.((((((((((..(((((..........(((.(.((((((((......((((((((((((..((((...((((((((((.((((((...)))))).))))))))))......)))).........(((((((((((.......))))))))))).(((((.......(((((.......)))))...)))))..)))))..)))))))(((.....)))(((((((((((((...)))))))...)))))).(((......)))))))))))).)))..)))))..)))))))))))).)))))))))))))))))))))))))))).)))))))))))).)))....))).))))))....))))))).))))..)))))).)))))))))).............)))))..))))))..))))))).))))).)))....)))).).....))))))))).)))))....))))))))))))))))........(((((((((....(((....)))..((((((((((((.(((((((((((((.((((.((....)).))))...))))))))))..............))))))))))))))).((((...)))).....(((((((((..((((((....))))))..))(((((.......)))))........))))))).....))).))))))....)))))))))..............)))))))))).)).))).)))))))..))))))))))))))..))))))).)))).)).)))..)))))).).)))))))))((((((...............)))))))))))).)))......(((...))).))))).))))))))))...))..))))).))))))))))).)))))))).))))..)))))).)))))).))..)))))))))((((((((......(((.(((.....((((.(((((((..((((..(((((.......((((...((((((..((((((((...(((((((.(.((((.((...)).)))).).)))))))...))))))))..)))))).))))..........))))).))))))))))).))))...))).)))...((.((((((..((((((((((....))))))..))))..)).)))).))...))))))))((((((((..((((...))))..))))))))........(((((...(((((((....(((((((.....(((...(((..((((((((...)))).)))))))))))))))))...))).)))))))))........(((((..((.((((((((.....)))))))))))))))(((....))).))))...)))))))))(((((((.........))))))).........(((((((((.((((((((....))))...)))))))))))))...(((((((...)))))))........)))))))...))))).....))))))))..))))..................(((((...)))))......)))))))).))).)))))))....))))))).))))))...).))).))))))).)).....)))))))))).))))))...))))................)))))).))))))...(((((((..(((........)))))))))).((((((((((...((((((......(((.((((((......))))))...)))......)))))))))))))))).))))))))))))))..(((((((......((((............)))).......)))))))..(((((......))))))))))))))))).....)))))(((((((.....))))))).)))).)))))))))..))))))).))))))))..................)))))..((((.(((((((((.....)))))).....))).))))((......))...(((((........)))))..)))))))))).
Thermodynamic Ensemble Prediction
(((((((((((({{(,,{.,|,||,||.|||||{{{|.{(.,..|}}}))}}|,,...|.(((((.,,,,,}}}}|.,|.|).|}.})))),},}})}||},},}},.}|}((.(((((((..((......)).))))))).))}}}},,......,{{{{{{{{{{,,{{{{{((((((((((((((((((((((((((((...((((((((((((((((((((.,.(((((((((.......))))))))).,.)))).......))))))))...,,(((((((((((((((((((((({{(....(((((......)))))....))},}))).))))))).)))...})))...)))).,)))))))).,..((((((((((((((.....)}},.{{{...,.((((((((...)))))))).},,,}||(((((((((...)))))))))||,....,,.,,.(((((..,,{{{{,.((((({...))))))...,|,...,...((((....)))),)))}......))))).}},},.,..})))))))))))..},.)))))..))))){{,..,,|}}.....}))))))).......)))))))))},...,.,,,..||||},..((((..........)}))...||||{{{,((,({.,.,,..,,.,||||}||,((((((....))))||.{(((........)))}.,,{{{|{..(({.(((((......))))).}))((((((((.(((((((..(((((((((((((..(((((((((((((((((((((.((((.((((.(,...{(((({...}))))}..).)))).)))).)),..))))))).,,.{{{(((((((((.....(((((((..(((.....)))..))))))),(((({...(((((((((......{..,.........,((((..(((.((((((((((({.(,{(((((((.((........)).)))))))))))))).....))))))).))}..,.)))))|,.,.}}.)))}))))))..},.}})}}(((((((.,.{{,..,})}{{.(((.(((..........))).))).})(((((.((((((.((((((((((.(((..(((..........(((((((((((((((((...))))))))))))).))))...((,{((((((((((..,{{{..........{{||||...{{,(((((({(((({(({{{{(,(((((((((,,,,{.,(((,,.,.,(({(.....||||,,,......|||,......|||{||}}||,||.,||||{{{,,,,..)))))))......))),))|||||||||||||{,{(({(((....,,||||||,((((((({,{{(((((((({..((((.((((.(((((((.{{(((((........))))).},.(((....(((((......,,.))))).,..})),(((((((.....((((....)))).....)))))))..))))))).))))..))))...))))))||{{,{{|{{||,..{{{|,||{{{..,}.{|{|...)))),)},.))))).}))),,}})))}|,.........(((,,,{((((.((((((((((((....((((....))))..))))))(((((.((((....)))).)))))........)))))).))))},...})),,{(((((((({((((((..((((.....)))))))))).}))..))))))}..}}}),})),,...(((((...)))))...(((((((((..((((.((((((((((((...(((((((.((.....)))))))))...,))))).))))))).))))..{,,{,,..,.({.(.((((((......))))))).)).,.||}||}.(((((((((((((((((((((((((,(({{......,(((....))).,(((((|(((|...)}))).)))))))).))))}}})))))|{((..(((((.({...}).}))))((((.((.({,{.(((((((.....{,.((((((.((((..(((((({((({,.....,,,...((((.(({...))))))){.((((((........))))))}...((.((((.....))))))..,))))))))...)))).)))))).,}))))))).})))),))))....},},((((((((.(((.(.((.((......))..))),)))..))))))))..}))))))))))}))).....,.((((((..((({..{(((.(((((((..{(.(((.(((((,...(((......))).....))))}.))))}((.((((((((.......)))}....,)))).)).((((((((((((..........))))))))))))......(((((((((..{{.(((((((({...})))))))).}}..)))},)}})))......(({..((((,...}}}}}..})).....,}}|||,(,...,.})).......))))))))))))))..)))))).{{((({|.(((({.,.|{|.|((((({,,,{(((((|{(((((((.....)))).)))}................{(((((.(((....(((((..((((((......))))))...)))))......))))))))}..((((((((.((.....)).)))))))).,.......,.))))))))))))).,.,}.,,.,))))).}))))}}..))))))))).)))}}))))))})))))))))))))))).)))..))).))))).)).))).)))))))))))))))))).....))))))))).))}...,...))))))))))))((((.{..((.......)).}.))))..(((((.(((((((({,((({((.(((((((..{{((({(,{{,,,,,,{{{,((((((((...}))))))}.{((({{..,{({(,(((((...(((((({.....))))))})))))....|||.||}}}})),.,,}{{{{(.((((((.((......)))))))).....,)))}.||,,,,||,|||,{,((((,(((|{|,,,,,,(((((((({{,(((({.,{{{,.,|((....}},||||.{{{{,||||{((((((.((((((((((((.,........}..))))))))))))..)))))).,,,...))))))))),,,))).))))).),}))))))))...|,,,.}}..)))))),})}})){.((((((({...)))))))).,,}))),.,,,,)..)))))))))|{,{.(({..,,(((((((.....{........}.....))))))))).,}}.},,..||,..(((((((((((((((((((((.{(.{{,(((...})),,.)})))))))}.,.((((.((..((((...))))..)).)))).},.{((((..((((((((((,,((((({,(((((((((((......((.((((((........))))))}},,))))))),(((({{{{{{{{{((({..{{,{{{.{,{{......}}...|||,}},...,,|}))},..})}},,,)))))))}.((((({....})))))...})))))}}}..}}|.})))))))..))))}.....{(((({.....((((((..(((((((,,,(,{{{(({,......{{,({(({..,{.((((((((((..,(((((({,.((((((((...,,(((((((,..(((,{{{{{(((((((....)))))}|,.....,,.(((((((((({{,(({{,,{{{.......||{{{{{|,|||(((,,,,(,,,{,,,,|,},.,,,)))}}}}}||}}}}{((((((((({{,...,,)))))))))},,,,||{{(,,.({{{((...(((.(((((((((..,,,..((((.(((...))).)))),,,...))))))))).))),.,}|||||{{{.{{|,(({{{{||||,,,,{(((.({{((((((..(((((((((((((((.((........)).))))))(((.(((((((((((...(((((.((((((((((((((((((((.((((((........,....(((((((((.{.((((((....((({.((.((((.(((((((..,.{{{..(((((....((((.....))))..))))){{{.{{|.,((({{{(({{.,,,..(((((((.(((((.(((((({...})))))).)))))...)))))))))))).((((((....)))))).((((({...)))).)).(((((((.(((.((,((((((((.(((((((((((..(((.((((,{{{||,||{{((((((,.{((((((((.,.((((((....)))))).|,|}}|}}||||,,,...,,{,.||.,,}),})}),)))))),..)))},|.)))..))))))))){((((((((.{({{.........,}}}((((((({....|{|.......)))....,.{(((((((..((({{.(((((((((....,(((......|||,,{(((..((((,(((..((({....)}||,}}|,|}}},,{{{{,{{,(((((((.,.(((.((((.(((((.((((((((((({(((({...{((({{,.,,,,........{,{,,{{...||}}|}|||,}}}}}........{((((((((,{{.,..((((.....))))..,{{,{{(,......))}))).)))))))))|||||,,,}{{||}||||(|.,(((((,,,,|||}..}))),.))))}))))}.)),})))))))))))))).)))).))).).)))))))...|{{{{{,{{||{{((((((((((..(((......}}}{(((((,.((((.(((((((...((((((.{((....(({.({.{((((((...(((((..((((((({......(((((((((((((,(({((,.,.{((................,...))).,.,)}})},))})},...,((.(((...}}}.}}.,{(((...,.......,{|||||.....((((......(((((..((((.....))))..)))))))))(((((.((((..(({,(({....{(....((((((.{{...)}.)),,)))....}}..})))))..)))))))))....((,((.{{(((({{....,,.,}}}}}.}}.}}.......,.,,,,,,,..........{((((((((,...{(.(((({.((.((((...})))...))}}))).}}.....))))))))}(((((((((......))))))))),,}}}}},|,,,....,,)))),..{({{(((((,,.......}}}}})))}...(((,,..,,,.,}))},,,})}}}))))))}}.,..(((.(((((....))))).}))....(((((....))))).........,((((((((((({{((((((,{.((,(((((((((((((({.....,,,.((((((((((({{(((({{..((,,((((..{{.(((((.......((((((((((((....((.((((((((({,((((.((..(((.....}|},,,,,,...,{,...{{,,,.}||{,..,})}}.,)))))}}}...|,,.......,,......,...((((((.,......((((........))))......................,,{(,.,((((((((((...)))))))))}.}}.((.....)}))))))....,}.))))))))))},....,.....}))).}}...))))))))))))..))))))}..,)))}),))..})))))}}))}..,))))))),,......})))}}}({{....}}}.......,,))))}}}},}},}}}},.....,,,.},,|{{{({.({.((((((((((..(((((..........(({.{.((((((((......{((((({(((({.,,,({,,.((((((((((.((((((...)))))).))))))))))...,}}}|}},........,((((((((((.......))))))))))}.(((({,......(((((.......))))).}.}})))..)))))..}))))))(((.....)}|((({(({((((({.,,|}))}}},},))))))}||{.,....))}))))))))),)))..)))))..))))))))))}),)))))))))))))))))))))))))))).))))))))))))}))),...})}.))))))....))))))).))))..)))))),))))))}}}|,,...........}))))}})},}))},)}})))),)))},.}}}..,,}})},},....))))))))).}))}).,,.)))))))}}}}))))),},...,,(((((((((....(((....)))..((((((((((((.(((((((((((((.(({{,((....})})))),,.}}))))))))...,},........,}})))))))))))).{(((...})))..,,,(((((({{{,,((((((....)))))}..},(((((.......)))))....,,,|})))))).....))).)))))},,,})))))))))............,.)))))))))),)).))).))))))),,)))))})))))})),}))))))).)))).))}))),.)))))).}.)))))))))((((((..{..........},)))))))))))).)))}..,..(({...))).))))))))))))))))...))..))))).))))))))))).)))))))).))))..)))))){{{{{{|{|...,},,}.,|.((((((((,.{{,.((({({{.,,,.((((.((((((((((((.(((((((....,,}}|,}))).}},))))|({(((((,..(((((((.{.((((.((...)).)))).}.)))))))...)))))),}..{((((..{{((.,........,))))..)))))))))).))))...|||{||}...,|,|||{{(..(((({(((((....)))))}..))))..)),}))}.))||,)))))))},.{.(((((((((((({((........)))}.,)))))))))).||,.}}))))).)))),}..,)))))))}..,{{{..((((((({...}))).))))}}}}}}}}}}}),,,,}}},|||,{{{{,,,..||,,,.,,...}}}))}}}})},.,)))},,,))))))))))((({{{{|,,..,,,...,,,))))))||(((({.,,.....,}}}}})).........(((((((({{((((((((....))))...)))))))))))))...{((((({...}))))),...,....,,||||..|{,|{(((((((..((((((.,|..|{{{.({.,......}}.}}}},,...))))))))...)))))))))..},.,.)))).,}}).))),)})}}}),.}}))......))))))))...,,,.})),)))..))))))).)))..}}..))))}.))}...,},)))}..})))),.}))))))..))))))..)))))).,,,,...{(((((((((...((((((..,,..(((.((((((,....,))))))...)))..,,..)))))))))))))))).)))))))))))))),,|((((((....{,((((,.......,.,.)))}.}}....))))))}..(((((......))))))))))))))))).....)))))(((((((.....))))))).)))).)))))))))..))))))).))))))))........{{{{,,....,)}))||({((,,{((({,,,.,,,.,}}))).,,|||||.},})}}},.,}})}..,||{{{........)}))).,))}))))))}.

Transcripts

ID Sequence Length GC content
NM_198700.3 NCBI
AUACUUUGAAAAUAACAGCUCUUUUUUGUUCCCUCGUGUGUCUCUUCCC… 4647 nt 0.4616
Showing 91 to 91 of 91 entries
Summary

Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. This gene may play a role in myotonic dystrophy type 1 (DM1) via interactions with the dystrophia myotonica-protein kinase (DMPK) gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that upregulation of the CELF1 is a molecular change linked to myotonic dystrophy (DM) cardiac pathology due to repeat-associated stabilization [Lee et al. DOI:10.1093/hmg/ddac108]. A study in a human patient demonstrated that expanded CTG repeats in DMPK cause dysregulation of splicing regulator proteins, including CUG triplet repeat RNA-binding protein (CELF1), which is involved in the pathogenesis of myotonic dystrophy type 1 (DM1) [Yamamoto et al. DOI:10.1016/j.forsciint.2019.109906]. This dysregulation leads to widespread abnormal RNA splicing of genes like LDB3 and SCN5A, providing a molecular mechanism for sudden cardiac death in asymptomatic individuals, with RNA-seq analysis serving as a useful tool for postmortem molecular diagnosis.