Basic Information

Symbol
CELSR1
RNA class
mRNA
Alias
Cadherin EGF LAG Seven-Pass G-Type Receptor 1 CDHF9 FMI2 ADGRC1 HFMI2 ME2 Adhesion G Protein-Coupled Receptor C1 Cadherin Family Member 9 Flamingo Homolog 2 Cadherin, EGF LAG Seven-Pass G-Type Receptor 1, Flamingo (Drosophila) Homolog Cadherin, EGF LAG Seven-Pass G-Type Receptor 1 (Flamingo Homolog, Drosophila) Cadherin, EGF LAG Seven-Pass G-Type Receptor 1 Flamingo Homolog 2 (Drosophila) Protocadherin Flamingo 2 LMPHM9 HFmi2
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Sudden death from CNS diseases

MANE select

Transcript ID
NM_001378328.1
Sequence length
11559.0 nt
GC content
0.6225

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-5035.70 kcal/mol
Thermodynamic ensemble
Free energy: -5224.33 kcal/mol
Frequency: 0.0000
Diversity: 2507.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((((.((((((.(((((((((.((.((((((((((((.((((.((((.....((((...))))....))))..)))).))))).)))))))(((((...((....(((..((((((((....)).)))))).(((((.(((((.(.((.(.((((((..((((((.(((......))))))))).((((((((...((((((((((((.(((((((..(((.(((((....((((((((..((((((.((..(((...(((((...(((((((((((..((((((......(.(((((((.((((((..(((((.(.((((.(((((.((((((((((((((((((((.((...((((((((((((...)))))).))..(((....)))(((((((((.(((((...))))).)))))))))((((((.(((((((((((((...((((((((((((((((((((((.(((((((((((.((((((((.((((..(((((......)))))..(((((((((((((((.((((....((((((.(((((((((.(((...(((....)))..))).).))))..))))...)))))))))))))))))))).))))).)))).).))))))).)).)).))))))).)).))))))))).))).))....))))))((..(((((((...)))))))..)).(((((..((((((..((((((...(((((((.....)))))))....)))))).))))))..))).))........)))).))))))))).))))))....))))..))))))))))))))).))))))).))))).))))).)))))((((((.(((((((((.(((((..((((.(((...))).))))...........(((((..((.((.....))))..)))))...)))))..))))))).......))..))))))(((((((.(((..((...(((((.((((((((((....)))))))))).))))))).)))((((((..((((((((((((.((((.(....))).)).)))))).).)))))..))))))))))))).(((.((((..((((((((.....))))))))..)))))))..)))))))))))))).((((((((.(((((.(((((..(.((((((((((..(((....)))))))))).........))).)..))))).))))).((((((((((.(((((((.((...((.(((....))))).)).)))))))))).......)))))))))))))))(((.((((..(((.(((....((......))....))).))))))))))((((.(((.(.((((((((..(((((..(((..((.(((....))).))..)))......)))))....)))))))).)))).))))((......))........((((((.....)))))).....)))))).)))))))))))..))))).....))))).)))))).))))))))....))))).)))..).)))))))))..)).)))))))((((.(((((.....((.(((((.(((((....(((((.(((((((((....)))))))))))))).....(((((.....))))).)))))))))).))......)))))))))..)))))))).))))))).))...).))))).))))).)))....))...)))))...(((((((((.((((((((.(((((...)))))........(((((..(.((....)).)..)))))(((.(((((((((((((........(((((.(((.((((.(..(((((((((......))))...((((....)))).)))))..)))))))).)))))(((((..((((.....((((....((((....))))..))))..)))).)))))..))))..))))))))))))...((((((((........(((((.....))))))))))))).......)))))))).....))))).)))))).)))))))((((................)))))).)))))).)).))))).((((.(((...((((.((.....)).)))).((((((....(((((((....)).)))))((((((((((.((((....)))).)).))))))))((((.(((..((((....((((((((...((((((((((.(((.(((((((((((((((((((((((((.(((((((((.(((((.(.((((....((....))...)))).).))).)).))))..)))))...........(((((((((..(((...)))..)).)))))))...(((((..((((....))))..)))))))))))))))((((((....((((((.......))))))..))))))..))))))))))).)))).)))..((((((..(........)..))))))))))))..((((((.(((.(((((......))))).)))))))))(.(((((((.((.((((((((((((((((.((((.((((.....))))......(((((.((((.(((((((...(....)...)))))((((.((((((....((((.((((((((((...(((((((((((((((..(((..((.......))..)))..))).))))))).)))))........(((((((((.((((((..(((((((((((((((((((.(((...((((((.....((((((((((((((((.((..((((.(........).)))).....))))))))))))))))))...((((..((....(((((.((....)).))))).))..)))).........))))))...)))))))).)))))...))).))))))...))...))))((.(((.(.((((.(((((..((((((((((((((((((.((.....)))))).....)).)))..)))))))))..(((((((..((((((((((((...................(((((((((.(((....(((.....((......)).....)))...))))))))))))((((((((((......(((((((((............)))))))))..(((((.......)))))(((((....))))).((((((((..((((((..(((((((((((.(((.((.((((..(((((............((((..(((..((((((...))))))..)))..))))((.((((((...((((((((..(((..((..((((....((((((((((.((((.(((...)))))))....(.((((((((((..(((((.((.((.((((((((((................)))))))))).)).))..)))))....)))))))))).)..(.((((....)))).).((((((((.((..((((....))))..((((((..(((......))).........)))))).((((.((((((((..((.(((((..(((((.(((((((((((((..((((.((....)).)).))...)))).........))))))))))))))...)))))((((((((((((...((((((((.(((....))).)))))..(((.(((.........))).))).....))).....)))))))))))).......))..)))))))).)))))).))))))))....)))).))))))..))))..)).)))..)))))))))))))).)).((((........))))..(((((((.((.(((((((((((.((.((..(.(((((((.(((..(((((.(..(((((...)))).)..).))))).))).))))..((((.......))))..))).)..)).)))))))))))))..)).......((.((((((.(((.(((((((((((.((....((((.((.(.(((((((((..(...((((((.....)))))).((((((.((((((.((((((((..(((((.....))))).(((((.(((((.((((((....))))))((((((((..(((((((((........))))((((((...((((((........))).)))...))))))..((((....((((.(((((...((((..((.((((((.((((.(((((((((((((((((((((((((((((.(((.((((....)))).))).)).((((((((.....(((((.(((.(((((.((((((((((((.((((..(((.........(((((.((((((((..(((.(((((.(((((.....)))))..))))))))........))).)))))((((((..(((..(((..(((((........((.(((((((..(((((.(((((((((((((((((((((((((((.....)))).).....((.(((.(((((......)))))...))))).(((.((((((.....((((....))))..)))))).))).(((..(((((...((((((((.((.......)).)).))))))...)))))...)))((((((.((((((((((((.(((.((.((((((((.((((((...(((....((((((((.((.((((.(((((..(((((.(((.((((((((((..(((((((((((...(.((((((((....((((((.....)).....))))..)))))))).))))))))((((...................)))).))))..))))))....)))).......((((((........))..))))(((((.....)))))..)))..)).)))..))))).)))).)).))))))))))))))).)))))).)))).)).............)))))))))...........)))))).)))))).))))))))))))....)))))(((.(((((...............)))))))).(((((((..((((...)))).)))))))........))))))))))...)))))))...))........)))))..))).)))..)).)))).(((.(((((...((((...))))...(((((..(((((((((((......))))...)).)))))...)))))...((.((((.((((.......)))).)))).))..))))).))).......))))).))).)))).)))))))(((((.(((((((.(((.......))).))).)))).)).)))...((((....))))..(((((..(((...))).)))))........)))))...))))).)))))))).(((((..(((((((....))))))).........)))))(((......))))))))))))))))))))))))(((((((.....)).)))))((((((....((((.(((((((..((.((((.(.((.....)).).)))).))..))))...)))))))...))))))....(.(((((....))))).).(((((((((((.(((((((((......(((((....)))))......)))))))..))..))))...((((((......))))))...(((((...((((.....)))).)))))..))))))).))))))))))).))).)))).)))))).))....(((.....))).)))).))))).)))).....).)))....))))).))))))))....(((((.....(((......)))...)))))))).)).)))))))))).))))))))).))))))...)..))))))))).))).))))...)).)))..)))...)))))))).)))))).)))))))))...((((((.((((((.((.(((((.((.((((..(((((((((((((((.(.(((.........))).).)))))))...)).)))).))...)))).)).))))).))))))..))))))))..)))))...)))).)))).).)).)))))))))..)))))).))))))))......))).)))))))......))))).))))))))))..))))...(((((((.(....((((((...((....)).))))))....).))))))).))))))))).).))).)).((((((.((..((((((.....((((......))))......)).)))).)).)))))).((((...))))....((((......))))))))))))).(((..(((.(((...(((...((......))...))).))).)))..))).(((((............)))))(((((......((((.((((..(((((((((((((..((((((..((.((((((((((.(((.((((((..((((((..(((....))).)))))).))))).)..))).)))))....((.(((......)))..))..(((((((..(((......)))..))))))).....((((((((.((....((((.(((((.(....).))))).)))).....)).))))))))))))).)).))))))(((...))).......))))..))))).)).))..)))))))).....)))))))))))))))....))))...............((((.(((((((.((....))))))))).)))).))))))..)))))).)).)).))))))))))))..))).)))))))..))).)).))))))).).(((((....)))))..))))...))))))))......))))..))).))))....))))))(((((((.....(((((......)))))((((((((((.((.((((((((.(.(((((((((((...........)).)))).....(((((((((((((((((((..((((.(((.....(((((..(((((..(.(((((....(((.(((((((..((....(((.(((((.(.((...(((((.((((((.((..((.(((((...))))).))(((((.....((((.....((....))...))))...((((.....((.((((((.(((.((((.....)))).....(((((.(...).))))).))))))))).))..))))..(((((((((((((.((.((.((((((((........((((((...((((((((.....))))))))......(((((......).)))))))))).)))))))).....(((.......)))...(((((((..(.((....))))))))))((((((..(((((.(((((.((((..........))...))))))).)))))))))))........)))).)))))))).)))))..(((.(((.(((.((((.......)))).)))))).))).(((((.((.((.(((((((........))))))).)).(((((.....)))))(((((.(((.......))).))))))).))))).))))))).))))))..)))))...)).).))))).)))...))..))).)))).)))...))))).)..)))))..)))))))))))).))))))))))..))))))))).))))).)...))).)))))...))(((....)))....((((((((((..(((((((.(((........)))..((((....))))(((((((.(((..((((((...))))))...).)).))))....))))))))))..))).))))))))))))))))))))))))(((((((((((..(((((.(((.((((((.((........)).)))))).(((..((.....)).)))(((((.(((((((((((((.((((((((((...((((((((((((((((.....))))).(((....)))))))))..)))))...............))))))))))...))..((.....((((.((...)).))))....))((((((((((...(((((...((((...(((((((((((((..((......))..))))))((((((..(((.(((((((((((......))))))).)))).))).)))))).....((((...))))......((((((((((((((.....((((.((((((((((..((.((((((((...(..(((((.............)))))..)...((((((.((((((..((((....((((....(((((((((....))))......(((((.....)))))....((((......))))((((((.((((....((((.((((((.((((((((((.....((..(((((..((..........)).)))))..))((((((((((.(((((((((((...(((((.....(((((..((((((......((((((.((((((((((((...(((..(((.(((.((((((((((((..(.....((.(((((.((.........)).))))))))..)))))))).)))).))))))..)))..((((......)))).)))))))((((.(((.(((.(.((.((((((..(((((.((...)).))))).))...(((((((......((((((...(((((((.....)).((((((..(((((((((.((...((....))....))))))))))))))))))))))....))))))))))))).......)))).)).)...))))))))))))))).))))))...((((((((((.(((((((.(..((....))..).)))))....)).)))))))))).))))))..)))))((((((.((((((..(((((((((..((((...))))..)))))))...))..))))))))))))..))))).....)))))..)))))).)))...))))))))))))))))).....(((((....))))).(((....))))).)))).))))....)).)).))))))((((((.(...(((((((.....((......))...(((((((.((((...((((.(((...))).))))....(((((((((((((.(((((((((((((.......(((.(.(((((((((.(((((..(((.(((.(((((((..((((((((...(((((..(((.((.....)).)))...(((((((((((((((((((.((((((((((((((((((((((.((((((........)))))....(((((((.......)))))))....((((.((((.(((((((((.............(((((....))))).((...((((((((.(((((.((......(((...(((((.(((((...(((....)))...))))).)))))...)))((...))((((.((.((((.((........)).))))...)).)))))))))))..))))))))...))))))))..))))))).))))..((((((((..((.(((.(((((((..((((((((((.(((.(((..(((.((((......(((((((((((((....))))).)))))))).......)))))))..)))(((..........)))....))).))).))..)))))((((((((...)))).)))).....((.(((((.......).)))))).)))))))))).))))))))))).)))).)))))))))))))....((((((.(((.(((....(((((.((((..(((((....))))).......))).).))))).....))))))...))))))..((((((.((((((((((.....))))))....((((........)))).(((((((....))))))).......)))).))))))..))))).))))....((((.......))))....(((((((..((((.((((((((((((........))))))))(((((....(((....)))....)))))....(((..(((((((((..(((.....)))..))))).....))))..)))..)))))))).)))))))((((((((....((....)).....))))))))..(((((...)).)))...)))))))).))).)))).))))).))))))))...((...))))))))).))).)))..))))).))....((((((...((((((.(.((.((......)))).).)))))).))))))...))).)))).)))).(((((((..((....)))))))))(((((((.....))))))).))))))))..(((((((...)))))))(((((..(((((....((((((...))))))...))))).....)))))))))).)))..)))))))))))))))))))))((((((((.(((((...)).))).)))))))).((.((((.((((((((((.(((((...)))))....))))))).))))))).))....)))))))).))))))..(((.(((((((..(((....))).)))))))))).................)))))....)))).)))).))))))))))))...((((((((.........(((((((....)))))))(((((.........))))).((((((((.((((((....)))...))).).)))))))..))))))))...)))))))).))..((((((....))))))...((((.......)))))))))))))))))).......)))))).)))).))))...((((.....))))......((((((((..((...(((..(((...)))...)))...))..)))))))).......))))).))...))))..))))))))))))..)))...))))))))))).))))).........))).))))).)))))))))))..))).)))).....(((.......(((((.(((.((((((((((((..((((.((..(((((((((((((((.((((((.((..((.(((.(((((((.......)))))))...)))...))..))))))))..)))))))).(((..((((..............))))..))).(((.(((((((((((......(((.(((.(((((((.(((.(((........(((((....)))))..........((((.(((...((((.......)))).))))))).......))))))))))))).))))))........))))).....)))))).))).)))))))..))))))))))..........))))))))..)))...))))).......)))..(((((((...((((((((...........))))))))..)))))))
Thermodynamic Ensemble Prediction
..(((...)))((((((.(((((((((({,(((((.((({({(({((((.((((....|(((|...||||..,.,,},.,}}||{,((((((.((((..(((((({(((..(((.(((((((,.(.(((((,({{((..((....))..)))|,||}.||,||}|.,||{||,{||,,....}))))))})},|..}}}))))).)))..)))}((((.((((...,.((((.((........)).))))....)))).)))).....))))))..)))).)))))).))}...,.})).}))))...,)))}.{((((((.(.((((.(((((.(((((((((((((((((((({((,..(((({{((((((...)))))).}}..(((....)))(((((((((.(((({...})))}.))))))))){(((((.((((((((({(((..,((((((((((((((((((((((.(((((({({((.((((((((.((((..(((((......))))).,(((((((((((((({,((((....((((((.(((((((((.(((...(((....)))..))).)))}))..))))...)))))))))))))))))))).)))))})))),).})))))).)).)}.)}})))).)).))))))))).))).))....))))))||,.{((((((,,,))))))),.))}(((((..((((((..((((((...(((((((.....))))))).}..)))))).))))))..))).))........)))).))))))))).)))))}....))))..))))))))))))))).))))))).))))).))))).))))))),))))}))){{{{||,||{{{...((.(((((((((((((((((((((.((((((((((,((((((((((.(((((.((((,,((((.((((((.((.......,...)).))))))))))..))}}{|,|,(((((.((((((((((....)))))))))).))))).,..,}((((((..((((({((((((.((({.{.,,,}}}.}}.)))))).).)))))..))))))((((..({(({(((((..((((((((.....))))))))..))))).).)))),.))))))))).)).)))|||}.((((((.....))))))..,,,|,{((..(((((.((.((.((((.((((((..,.(((((((..,,((.{(((((((((.(((((((.((...((.(((....))))),)|.))))))))))}......{((((((((((((({,((.(((({(,((,{(,{,,.{({{,...|.,,{.|}}.|||||||||,{(((.(((.(.((((((((..(((((..(((..(({({(....}))})}..))).....,)))))....)))))))).)))).))))|}}...............,((((((((....,..},,,,.))),,..)}}|||{{,,,||}..,))))))})))),)))))),}}{(((....))}|((((((((((.((..(((.((({{(((((((((.((,.(((((...(((((.{({((((,,....(((....))))}))))}.))))))))))..(((((((((,(((.....||||.{(((((((((,.,({{..((((((((((|(.(((........))))).)))))).})})},{||},..}}}..)}.))))((((.(.....}.)))))))).(((,{((((...)))))}}}...))).)))))))))....,(((,,(((((((.{((((,{,,,,,,|}}}}...{(((((.(((.((((.(..((((({{({...,.{||||..,{{|{..,,)})).)))))..)))))))).)))))}{,,|{{{{{{,,.,.,....||......{{{{||...,,||{{|{|{.,}|||,{|||,.{|,|||,|||(({,,.((((((((........(((((,...,)))))))))))))...,.)))))),)))....,)}},)})),)|||||}}}})))))))).............))))))))))).|})).))))).)))))))}.},})..)))))))))))),,)))))))))))},)))((((.((({(((((.(((((((({(,((((....)))).)).))))))))((((.(((,.((((....((((((((...((((((((({.{{{.(((((((((((((((((((((((({.(((((((((.(((((.(.((((....{{....}},,,)}}}.|,))).}}.}})).,})))}.,,......({(((((((((..(((...)))..))})})))))..,||,||.,||(({{{.,,,,.})))))))))))))))((((((....{((((|.......,))))}..))))))..))))))))))).)))).})}.,((((((..(........)..)))))))))))),.((((((.(((.(((((......))))).))))))))){.(((((((.((.((((((((((((((((.((((.{(((,....}}}},.....({{{{.{({{,|{(((((...{....}...))))){(((.((((((,,..((((,((((((((((...(((((((((((((((..(((..((......,)}..)))..))).))))))).)))))........(((((((((.((({((..((((((((((((((((((,,(((...((((((.....(((((((((((((((((({,.((((.(........).)))).,,..})))))))))))))))))...((((..((....(((((.{,....),.))))).,},,)))).,..,,...))))))...)))))))).)))))...)))}}))))),,,||,..||||((.(((.(.((({,(((((..((((((((((((((({{{.,{....,)})})),....}}.))}..)))))))))..(((({{,..((((((((((((...................(((((((((,(({....{,{{,...,......})}....,}....,)}))))))))))(((((((.((..,,,,(((((((((........}...)))))))))..(((({,......)))))(((((....))))).((((((((..((((((..(((((((((((.(((.((.((((..(((((.........,,.((((..(((..((((((...))))))..)))..)))){|.((((((...((((((((..(((..((..((((....((((((((((.((((.(((...)))))))....{.((((((((({..(((((.{{.((.((((((((((....{...........)))))))))).)).}}..)))))....)))))))))).}..{.((((....)))).|,((((((((.{{..((((....))))..|((((,..(((......)))...}}},..,,,,||.((((.((((((((..((.(((((.,(((((.(((((((((((((.,(,((.((....)).)).,,,,.)))).........)))))))))))))).,.)))))((((((((((((...((((((((.(((....))).)))))..(((.(((.........))).))).....))).....)))))))))))).......))..)))))))).)))))).)))))))}.,..)))),,)))))..))))..)).)))..)))))))))))))).}}.((((......}.)))){.(((((((.{{.(((((((((((.((.((..(.((({(((.(((..(((((.(..(((((...)))).)..).))))).))).)))}..((((.......))))..))).)..)).)))))))))))))..}},,,....{|,((((((.(((.(((((((((((.{{....((((.((.(.(((((((((..{...{(((((.....)))))).((((((.((((((.((((((((,.(((((,...,))))).{((((.{{(((.((((((....))))))((((((((..(((((((((........))))((((((...((((((........))).)))...)))))).,,{{|....((({.{((((,..{{((.,(({((((((.,,,|}|||||{|||{|{{((((((((((((((((.(((.((((....)))).))).)).((((((((({{{.(((({{(((.(((((.((((((((({((,((((..{{((({......(((({.((((((((.,,(({(((((.(((((.....)))))..)))))}}}...,}.,,)))}})))){{{{{{..(((..(((,,((({{......{{({.(((({{(,,({{{.{((((((((((((((((((((((,((((.....)))).|......|.(((.(((((......))))).,.)))}|.(((.((((((.....((((....))))..)))))).))),(((..(((((.,.((((((((.((.......)).))})))))),,.)))))...)))((((((.(((((((((((,,(((.((.((((((((.((((({..,(((....((((((((.((.((((.(((((..((({(,((({((((((((((,.(((((((((((...(.((((((((....(((({(.....}}....,))))..)))))))).})))))))((((..{.,...........,..)))).)))).,)))))),...}))).,}},..{{{,(({{{{{{......|,,,,|,,,...}}))))),.},}..)).)))..))))).)))).)).))))))))))))))).)))))).)))).)),............))))))))}....,,....))))))).)))))).))))))))))))....)))))|||,,,{,..........{{{,,....,}}},.{{{((({..((((...)))).))}}))),....,,,))))))))))...)))))}).,,||........)))||.,|||,|||..||||||}.,,,.(((,,...((((...))))}},(((((..((((((((({{......,).,.},)).)))))...)))))...{{.((((.((((.......)))).)))).})..))))},)))},,,.,,))))),)))})))),)))))))|{{{(,((({{{{,{((,......})).))).)))),)).}}}...((((....))))..{{{||..|||.,,))),)}})),}......))))).,,)}))).))))))))..,{,,..(((((((....))))))).....,...}}}}}|,,}},,}}),,}))))))))))))))))))))|{{(({{.....||||||||{..{{(((,.{{|||||||||,|}||,|||{{{{(({{{{{,,{{{,,,}}}}}}.}}}|{.((((({{...))))))}.},,,|||{|,,,,||}||.,.(((((((((((.(((((((((....,,(((((....))))).,,...)))))))..))..))))...{(((((......))))))...(((((...((((,...,)))).)))))..))))))).}}))})))))}.))}.)))),}})))).)),,,.|||,,..})))})},}.))))}.)))))},,.}})}),},.))))).))))))))....(((((..,..(((......))),..)))))))).}}.)))))))))).))))))))).))))))...}..))))))))).))).))))...}}.})}..)))...)))))))).)))))).}}))))))),..((((((.{(((((.((.(((((.((.((((,,,(((({{((((((((.(.(((.........))).}.)))))))}..,),))}}.))...)))).)).))))).))))))..,}))))))..)))))...)))).)))).).)).)))))))))..)))))).))))))))...,,,))).)))))))......))))).)))))))}))..))))...(((((((.(....((((((...((....)).))))))..,,,.))))))).))))))))).).))),)).((((((.((..((((((....{((((......)))},}....)).)))).)).)))))).((((...))))),,,||||,....,)}))))))))))).(((..(((.{((...(((...((......))...))).))}.)))..))).(((((..,......,..)))))(((((....,.((((.((((..((((((((({(((..((((((..((.((((((((((.(((.((((((..((((((..(({....))}.)))))).))))).}..))).)))))...,{{.(((......)))..)),|(((((((..(((......)))..))))))).....((((((((.,,....((((.(((((.(....).))))).)))).....)}.))))))))))))).)).)))))){{{...)))..,,...))),..)))))},).))..)))))))),....)))))))))))))))....}))),,..,,,........((((.(((((((.((....))))))))).)))).))))))..))),,}.),.}}.))))))))))))..)))}}})))))..))).)).))))))).,.(((((....)))))..))))...)))))}))......)))),.))).)))}.))))).))))))))|||||,,{((((......))))|({(((((((.....,,,{{{.,||..,,.))..)}}{({{{{(((.(((((({{.((((((((((.((((|(({{{((((,,..}|}{{((((({(({({({((({.{,{{{({((((((((.(((((.{{(((.{{{{||{....})},,,.{((((((.{...,{{..(((.(({((,..}}))),))}..,))...,).))))))|((((((((((.(((((..,.((({,..,(.((((((.{{{.||||,,.,,,},,.,...(((({,(...|.}}}}|.}}}}}}}}}.}}..,.,,...((((((....))))))({.((((((((........((((((...((((((((.....))))))))......((((,,.....}.)))))))))).))))))))..,},{((.......)))..{(((((((..{.((....})}))))))))}))),..))))).))))).....)))))},)))))}).))))})),))))))))}}...,.....}}}}.,,||}((((((...))))))(((.(((.((((.......)))).))))))({({.{...,}||}((.(((((((........))))))).)).{||||,.,..)))))})))})|,.,))))))))).....)))),,))}.)))))).))))))}}})))))))))}}))})))))),.,,.....))))))).}..)))))).)))).)))))))))..))))))))).))))))))))))).....)))))))))))).))(((((.,.....))))}......{.{(((((((((((..(((((((.(((........)))..((((....))))(((((((.(((..((((((...))))))...).)).))))....))))))))))..))).)))))))))},.)))))))))))((((((((((((..(((((.(({.((((((.((........)).)))))).(((..((.....)).)))(((((.(((((((((((,{,((((((({{,..,{(,,.,.,)))|((((.....))))}|{(((..{{{((({{{{{,{.{{{,{{{{{{....,,,.||,|,|||,,..})),}}||.....}})})).,.|,{{{{{{.....))}|||,|,{.},||||{}}}||,{.,.{{|||(((((((({,{{......}),.))))))||((((..(((.(((((((((((......))))))).)))).))),)))}||{{...((((...))))......((((((((((((((...,.(({((((((((((((..,{.((((((((...{,.(((((.............)))))..|||.((((((.((((((..(({{....((((..,.{((((((((....))))......(((((.....}}}}}...,{{{{......))))((((((.((((....((((.(((((({((((((((((.(.((.(((((.,...((((.,....,{|...,,,}...,,|.|})}(((.(((((((((((...(((((.....(((((..((((((.,,.{.((((((.((((({((((((,..(((..(({,(((.((((((((((((..(.....((.(((((.((.........)).))))))))..)))))))).)))).))))))..)))..((((......)))).||}}|||(((({((({{,{.(,(,.,{(((({.{,,,,.||}}},)}))}})}))}}.||||||,.....(((((((...(((((((.....)).((((((..(((((((((.((...((....))....))))))))))))))))))))))....)))))))))))}}..,}.,,)))),},.|,{,|,,,})))))))))).))))))..}((((((((((.(((({((.{.,((,,..}}..),))))).,,.)).)))))))))).))))))..)))))((((((.((((((..(((((((((..((((...))))..)))))))...))..))))))))))))..))))).....)))))..)))))).)))))))).)).))))))))))).....(((((....))))).|{{....))))).)))).))))....)).)).))))))((((((.,...(((((((..,,,,|}}....||.{{(((((((,(({(,..((((.{{{.,,})).}))),,,.(((((((((((((.(((((((((((((..,,,,.,,,.{.{((({({((.(((((..(((.(((.(((((((..((((((((...(((((..(((.((.....)).)))...(((((((((((((((((((.((((((((((((((((((((((.,(((((.,....,.)))))....(((((((.......)))))))....((((.((((.(((((((((..........({.(((((....)))))}}|...((((((((.(((((.((..,,..{{....(((((.(((((...(((....)))...))))).))))),{.|||,{....}{|||,{(.{(((.((........)).))))}},}).},}))})))))..))))))))...,,)))))),.))})))).))))..((((((((,.{(.(((.(((((((..((((((,(((,(((.{((,.(((.((((......(((((((((((((....))))).)))))))).......)))))))..}}|(((...,......))).,,.))).))).},..))))}((((((((...)))).)))).....({.(((({.......}.,)))}}.)))))))))).))))))))))}.)))),}))))))))))))...{((((((.(((.(((..{.(((((,((({({(((((....)))))}......})).}.)))))..,..))))))...))))))}}((((((.(((((((({{.....}}||||....,((({{,.{...,,),,|{{||||},},)),}},,.....,})))).))))))..))))).))))....((((.......)))}....(((((((..((((.((((((((((((........)))))))){{{({,...{{{{{{{|}|{,|{}|||,....{{{,,|{||||||,,,{||}}},.},|,,|}},,,}},,}}}}..,.}.,)))))))).)))))))((((((((....((....)).....)))))))).,((({{...))),))...)))))))),})).)))).))))).))))))))...{{...})))))))).))).)))..))))),|,{,,,((((((...((((((.,.{(,{,......)})}.).)))))).))))))...|||{||}|{,,,,.|||||||,}}}}.,,,.}}}}))){,|||||},.,,))))),,.))))))))..(((((((...)))))))(((((..(((((....((((((...))))))...))))).....)))))))))).)))..))))))))))}})))))))),((((((((.((({,...,}.))).)))))))).((.((((.((((((((((.(((((...)))))....)))))))},)))))).))....)))))))}.)))))),.(((.(((((({..(((....})),))))))))))..,..............)))))....)))).}}}}.)))))))))))).,,((((((((.{.,,....{((((((....))))))}{((((.........))))}.{(((((((.(((({(,,..}}},,.))).).)))))))},))))))))...)))))))).}}..((((((....}}))}}...||||.......,}},)))))))))))))).......)))))).)))).))))...((((.....))))......((((((((..((...(((..((,...,}}...)))...))..))))))))....,,.))))).}}...,}}}}.})))))),,)))}},))...))))))))))).))))).........,)).))))).))))))))))))..((((((((((.({({,{.((((((..,,,...,,....,||.,,...)))))).},}|.||(((((((((.((((((,{{..((.(((.(((((((.......)))))))...)))...))..})))))))..))))))))},(({{({{{,,.,.||,,....,|||}..}}}.{{{,{{{{{{(((({......{{{.(((.(((((((.(((.(((........(((((....)))))........,.,{((.(((...((((.......}))).))))))),}},...))))))))))))).)))}}}..,.....}}}}).....)}}))),))),))))}},}}).)))).)))))}.....((((((..,.......))))))......))))...(((((((...((((((((...........))))))))..)))))))

Transcripts

ID Sequence Length GC content
AAGCGCACCGCCCAGGCAGCAGCCGGCCGCCGGGGUCUGCGCGGCGCGG… 11559 nt 0.6225
AAGCGCACCGCCCAGGCAGCAGCCGGCCGCCGGGGUCUGCGCGGCGCGG… 11499 nt 0.6241
Summary

The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human cardiac tissue demonstrated that the CELSR1 gene, an atypical cadherin associated with ischemic stroke susceptibility, was increased in macrophages from patients with ischemic cardiomyopathy compared to both non-failing controls and those with dilated cardiomyopathy [Simonson et al. DOI:10.1016/j.celrep.2023.112086].