Basic Information

Symbol
CENPB
RNA class
mRNA
Alias
Centromere Protein B Major Centromere Autoantigen B Centromere Protein B, 80kDa CENP-B Centromere Protein B (80kD) Centromere Autoantigen B
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001810.6
Sequence length
2890.0 nt
GC content
0.6651

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1447.90 kcal/mol
Thermodynamic ensemble
Free energy: -1492.37 kcal/mol
Frequency: 0.0000
Diversity: 697.52
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((....(((((((((((.(((((((.((...(.(((((.((((.((((((.((((((((((((((.(((((((((.(...((((.((...))))))))))).))))))))))))..((.(((.((((((.((.........)).)))))).)))))(((((.(.((((.....).)))))))))..((((..((((...)))).))))))))))))))))))))).)))))).))))))))).)))))(((((((((((((......)))..((((.((((...(((((...(((.(((((..(((..........)))..))))))))..((((..(.(((....))).).)))).......))))).))))...)))).((.(...............).)).))))))))))...)).)))).....(((((((((........)))(((((.((..(.(((((((.......))).)))).)..))))))).....((.(((.((.....)).))).)).((((((.(((((((((..(((.((.(((....))))).((((..(((((((((..(((((((((((.(((..(.(((.((.(((......)))((((((..((((((((((((((.((.((((.(((((((((((.(.((((((((((.((.((((..(((....(((((((((((......((((.((((.((((((((.(((((..((((((...))))))))))).)))......))))).)))))))))))).)).)))))...)))..)))).)).)))))))))).))))))))((((...))))...((..((((.....)))).))............)))).)))).)).)))).)))))))))..)..)))))).)).))).)..)))..)))).))).)))))))))))))...))))...((((((.....))))))...)))..))))))))).))))))...)))))).(((((((.....)))))))(((.(..((......((..((((..(((((((...)))))))((((((.((((...........))))((((....))))..((((((((.((((.(..((((((((((.(((((((((((..(((((((((((.(((.((....)).))).))).))).((.(((((((((((...(((((((((((...........))))).))))))((((((((..(....)..))))))))......)))))).))))).)).))))))))))).)))))..)).))))))))..)))))))))))))))))))..(((((((.((((......((.(((((....))))).)))))).))))))).......((.(((.(((((((((((.((((.((((((....)))))).)))))).))))...((((((((....)))))))).)))))))).)).))))..))......))..).))).((((((...((((((((....((.(((((((((((....((.(((((.((((((.(((..((((((((.....((((((((((((((....((((((((((((((.((.(.(((((........((((((..............))))))(.((((((.((((((.((((((((((((((((((((..(((.((((.(.(((..((((.((((.......))))..))))..)))).).))))))((((((....(((((..(((((...(..((((..((((.....))))..))))..).........(((((((.((....((...(((.((.(.((((((.(((((..(((.(...(((((((.(.((((....))))..(((((((((.......))))))))).).)))))))).)))..))))).)))).)).).))))).))....)))))))))..(((((.(((.((......)).)))..)))))..(((((.((((.....)))).).)))).((((((.((((.(((....)))))).).)))))).((((.....((((......)))))))).)))))))))))))))).)))))))))))....(((.(((((.........))))).))).)))).))))).......))))))...)))))).)..(.(((((((((.....))))))))).)((((((....))))))))))).).))))))..))))))))))....))))).))))))))).......)))(((((((((((.((.((.((((.((((((((.(((((((((((......))))).(((....((((.....)))).((((..(((.(((.((((((((((((...(((..((((((.(.((...(((((.((((((...((.....))...))))))))))).......))).))))))...))))))))).....)))))).))).)))...))))..))).))))))))))))))...)))))).))((((..((((((((...))))..))))..)))).))))))))))).))))).))).)))))).)))))))..)))))))))))(((((((((((((........((((((((((...((((((...(((.((((((...))))))..)))...)))))).)))))))))).......))))))))).....))))))...))))))))))))))..)))))(((..((..(((((.((((((((((((((((((((.....))))))))..))))..)))))))))))))..)).......((((..(((.((((((((....).))))))).))).))))...)))..
Thermodynamic Ensemble Prediction
{((({..{{({((,{(((((.(((((((.((...(.(((((.((((.(((((((((((((((((((((.(((((((((.(...((((.((...)))))))))))}}))))))))))){{((((((.((((((.((........,)).)))))).)))).|||||.{.((((.,..{|,{|||,,}}}..,|))}}|{|||..}}})}))}}))))))))))))))))).)))))).))))))))).)))))|||||(((((((({.....|||,.{{(({(({(..,(((({,,.{||.{((({,.{{{,{,{{{{{|{{|...,||||}||.{((((..(,(((...,|||{|,||||,,,....||,))|))},...))}).||.|},},,},..,.....}}}|||||}},))))},}},.))))}.},.||||{|,,||}}}||}|,||(((((.((..(.(((((((.......))),,))).)..)))))))...,|,|||||.,,|,||.}},,|||||{((((((.(((((((({..(({.,,.(((....)))|}.((((.{(((((((((..(((((((((((.(((..(.{,,....(((......))){(((((..((((((((((((((.((.((((.(((((((((((.(.((((((((((.((.((((.,(((....(((((((((((......(((,{((((.((((((((.(((((..((((((...))))))))))).))}.....,))))).)))))))))))).)).))))),,.))},,)))).)).)))))))))).))))))))((({...}))}...((..((((.....)))).}}............)))).)))).)).)))).)))))))))..)..)))))},))}.,}}),.))),,)))).})).)))}))))))))).,.))))...((((((.....))))))...)))||})))})))}.))})))|,.||},,|,(((((((.....)))))))({{,(..{{...,,,((..({{(..(((((({...})))))){(({((,((({.,,.,,,{...||||((((....))))..||||{{{|,||||.|,,|||{||||{{.{{{({{((((|..{|||||{{{{{|({|.{{...})..)))}))),))),{{.{{{((((((({.{{(((((((((((...........))))).))))))||{||{||,,|.,,,|..}}}))}}}.,,,..|||||}.|||||.},.|)}}}}))))).)))}},.))}}))))})),.}}))))))))))}|)))}|,.|||||||}||.|||,...||,(((((.,..))))),)))))},)))))))}.....,{{,(((.({{{{((((((.((((.((((((....)))))).)))))).))))...((((((((....)))))))).))}}}}}}.)),)}}),.))......})..),}||.((((((...{(((((((.{{{(({((,((({(((({{{.(({(((((.((((({{(({..(((((.{{.....((((((((((((((....(((((((((({(((,({.{.(((((,.......((((((..............))))))(.((((((.((((((,((((((((((((((((((((.,(((.((((.,.(((..((((.((((.......))))..))))..)))}.}.))))))|(((((....(((((..(((((...(..((((..((((.....))))..))))..)...,{(,..(((((((.((....((...(((.((.(.((((((.((((({.(({....{(((((((.(.((((....))))..(((((((((.......))))))))).).)))))))).)))})))))).)))).)).).))))).))....)))))))))..))},,.......,((((((,....))))))}..(({((.((((.....)))),).)))).((((((.((((.(((....)))))).).)))))).{{{{{,,..{(({......})))}})).)))))))))))))))}.)))))))))))....(((.(((((.........))))).))).)))).))))).......))))))...)))))).)..,.(((((((((.....))))))))).|{(((((....))))))))))).).}),})),,))))))))))....))))))))))))))),,,,,,||||({{{{|||||{.||.((.((((.((((((((.(((((((((((......))))).(((....((((.....)))).((((..(((,(({.((((((((((((.,,((({{{,{(((((.,.}}}||{(({((((((...{(.....)}...)))))))))),.......},}.}}))))),.}}})))))).....)))))).))).)))...))))..))).))))))))))))))...)))))).)}((((..(((({(((...)))}..))))..)))).)))))}}}))).))))).))).)))))).)))))))..)))))))))))((((((((((((,.,,.....((((((((((..,((((((...{((.((((((...)))))).,)}}...)))))).))))))))))...,,,.})))))))).....)))))}...)))))))))))))))}}))})|||,,||..(((((.((((((((((((((((((((.....))))))))..))))..)))))))))))))..,|{{{,....|}}}}{((.((({((((....,.))))))).))}........)}}..

Transcripts

ID Sequence Length GC content
CUGCCUUCCGCGCCCGCGCCGCCCGCCCUCGUCUGCGCCCGUCGCCUGC… 2890 nt 0.6651
Summary

This gene product is a highly conserved protein that facilitates centromere formation. It is a DNA-binding protein that is derived from transposases of the pogo DNA transposon family. It contains a helix-loop-helix DNA binding motif at the N-terminus, and a dimerization domain at the C-terminus. The DNA binding domain recognizes and binds a 17-bp sequence (CENP-B box) in the centromeric alpha satellite DNA. This protein is proposed to play an important role in the assembly of specific centromere structures in interphase nuclei and on mitotic chromosomes. It is also considered a major centromere autoantigen recognized by sera from patients with anti-centromere antibodies. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human patients identified the CENPB as a potential biomarker for myocardial fibrosis after acute myocardial infarction, where it was the most up-regulated mRNA in that condition and was part of a predicted ceRNA network involving GAS6-AS1/SNHG22 and hsa-miR-135a-5p [Wang et al. DOI:10.2147/IJGM.S329391].