Basic Information

Symbol
CENPF
RNA class
mRNA
Alias
Centromere Protein F Mitosin Hcp-1 Centromere Protein F, 350/400kDa Kinetochore Protein CENPF AH Antigen Centromere Protein F, 350/400kDa (Mitosin) Cell-Cycle-Dependent 350K Nuclear Protein CENP-F Kinetochore Protein PRO1779 CILD31 STROMS CENP-F CENF
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_016343.4
Sequence length
10290.0 nt
GC content
0.4084

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2682.80 kcal/mol
Thermodynamic ensemble
Free energy: -2883.84 kcal/mol
Frequency: 0.0000
Diversity: 2413.60
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((....(((..((((((..((((.((((((((((...))))))....))))))))))))))..)))(((((((...(((((((((.......(((((((((((((..(.(((((.(((((((((.....((((..............)))).....)))))))))..))))).)..).))))......(((((((((....((((((((..((....))))))))))..))).))))))(((...(((...........(((((....((((((((((((....)).)).)))))))))))))...........)))...))))))))))).......)))))))))...))).....(((((.(((.....((((.........((((..((..((((((.((.......)).))))))..))..)))).........))))....))).)))))...(((.....(((..(((((....................))))).)))...)))...((((....)))).((((((...........))))))))))((((((((((((.(((.((...(((...................(((((((..(((((((((.................)))))).....))).)))))))....................((..((((((((((..............(((.((((....))))))).((((.........))))(((((((.......(((..(((((.(((((((.(((..((.((((((((((..((((.....((.(((((.((....)).))))).)).((((.((((((((((((((.((((...))))((((.....)))).........(((((((((((((((((((......(((....))).((((..(((..((((((......(..(((((((((((...)))).)))))))..).......))((((((..((((((((.(((.........((.((.(((((((((((((..........(((((((((.(((..((((........................))))..))).......((((((....((((.((((....))))..........)))).....))))))........(((((((.((....((((......((.(((((((((...((((...((((((((((((((((((((((...))).)))).................)))))).....)))).)))))..((........)).....))))....)))))))............................((((((((....)))))))).(((((..((((((((((((((.....)))).......(((.(((((((...((((.(((((......)))))(((((((((........((((((((....(((..(((((..(((......)))..)))))..(((....))).......(((((....)))))...)))...))))))))...((((.(..((.......))..))))).((((((((.....(((((((((((((((((...........(((((........)))))..((((..(((((.((.....)))))))...((((((.......))))))))))..((((((......)))))).....((((......((((((.............)))))).....)))).......)))))))......))))).............))))).......)))))))).(((((.....)))))))))))))))))).)))))))...)))....(((.((((((..................)))))))))...(((...((((((....))))))...)))..((((..(((..(((((..((((.((((.(.((((.(((((((((....................(((((.((((....)))).)))))(((((...........))))).....)))))))))))).).).))))..))))...((((...))))............)))))..))).))))..(((..............))).........((......))))))))))))..)))))))))......))))..))))))))).....((((((((.........(((.....))).)))))))).............))))))))).((((.....((((((...((((((((((((((.......))).((((.............(((((((..(((..(((((((((.......)))))).)))))).)))))))..)))).(((..((((..((......)).))))..)))((((((...(((...))).))))))....)))))).)))))...))))))....)))).....((((((((((((((.......).))))))))))))).))))))))))))))).)).((((((((....(((((((((((((.......(((.....))).......)))......)))))))))).(((((((((((((..(((....))).....(((((((.............)))))))(((((...(((....)))...)))))..........((.(((((..((((((....)))).))...))))).))(((..((....((((............))))......(((((((............))))))).(((((......)))))(((((..((((((.(((.((((((.(((((.....))))))))).)).))).)).)))))))))(((((....))))).....))..)))..)))))))))))))..........)).))))))(((((((((((.......................))))))...)))))...((((((.((.(((((.(((((..........)))))...)))))...)))))))).((((((((((.......))))))).))).....))).))))))))..)))))).(((((((..........)))))))....))))..)))..))))..)))))))))))))))....)))).......))))))))))........((...(((((....)))))...))..............((((((((..((((((((((((((((..((..............)).))))..............(((((((...........(((((...)))))))).)))).........)))..)))))))))))))))))....)))).))))...((((...((..((((((((((........((((..((((((((....(((((....))))).........((((..(((((((((...((((((((((((((..(((((((((((.((((((((((((((((((......((((((....((((((((((((((((........)))))....((((((.((.(((.((((((....(((.....(((((((((..((((((................(((((..((((..(((...(.......)....)))..))))...)))))..((.....)).(((((.(.........).))))).((((((((.....(((((((((.((......))...))))))))).....))))))))((((((((.((((((((.....)))).))))..)))))).))....))))))..))))..)))))......(((((..((((...((((((((((((.((...((((((((((((.((((...((((....(((..(((((....(((.....))).....)))))..))).....))))((.(((((((..(((.........)))))))))).))))))...))))))).....(((.....)))...((((.......))))(((((.................((((.....))))))))).....))))).)).)))))))).....(((..(((((..(((((...(((......(((.((((.....((((((.(((((((((.(((((((((.....(((((.....)))))......................((((((((.((((.(((((.(((((.(((.......))).)))))))))).))(((((((.....)))))))(((((((.(((((((((....((((....(((..........)))...))))....)))))............(((((((..(((((((((((((.((((..((((..((((((..........(((((........)))))((((((((((..(((...((((((((........)))))).)))))...)))))).))))..((((((((....))))))))...........))))))..))))...)))).)))))))))....))))..))))))).....))))))).))))...))))))))))((((((((.(..(.((.((.((((((((((..(((((((((....)))))......((((((((.............((((((.(((((((((((.....)))))))))))))))))......((.(((((....((((......((((((((....)))))))).....))))(((((((.....((((((((((.......))))))).)))......)))).)))((((...))))))))).)).(((((((.((....(((..........)))....)).)))))))...................))))))))..(((((((...((((((........)))))))))))))(((....((((...(((((((.((((((((((...((.......((((.(((....(((((((....)))))))....))).))))............(((((.....))))).(((((((((((.((......))))))))).))))((((((.(((..(((.((((((((.(..(((((((.........)))))))..))))))))))))..)))))).)))...((..(((......)))..)).....................))....)))))))....))).)))))))..))))....)))..((((((......)))))).))))..)))))))))).)).)).)..).)))))))).(((.((((((((....))))))))))).......((((((...(((..........))).))))))(((((((.....))))))).)))))))))))))).....)))).)))))).((((((((((((((....)))))))...))))))).((((..(((...)))..))))....((((((....)))))).(((((.....)))))....)))).))))))...)))))..))))))))....................))))....)))).)))))....(((.((.....))))).........((((((((.((((((((.......(((((((.(((((((...((....))...)))))))(((((((......)))))))..........((((((((((((....)))))...)))))))....)))))))))))))))....)))))))).......(((((((.(....((((((....)))))).....).))).))))(((((...(((((((....(((.((((....((((((((......(((...)))......))))..))))..)))).)))..)))).)))...)))))..(((((.(((((((.......).)))))).)))))...................)))....))).)))))).)))))))).....((((((.((....))..))))))..)))))))))))..)))))).(((.(((((((............)))).)))))).))))))))..........(((((...(((....((((((......)).))))..))))))))....((((((.((..(((((((((((.(((((((...........)))))))..))))).)))))))).))))))...((((....))))....)))))).)))).....)).)))))))))...............))))))))))))))....(((((..(((....)))..)))))((.((((.....((((.......((((.(((...(((((((....((.(((......)))))....))))))).))).))))......))))...(((((...)))))(((((............(((((((((......)).)))))))...........))))).)))).))......)))))).)))..))))..((((((........(((((...((......))...)))))(((.....))).......)))))).........((((......))))...)))))))).))))........))))))))))..........))...)))).))))..)))))))))).....((((..((((...((((..((((.............((((((((((((((((((......)))))))..((((((((((......))))))))))..........(((((.......................)))))(((((.......))))))))).))))))).........((((((...............))))))(((....)))..)).))..))))...))))..))))..(((((((.....((((.....))))...)))))))......))..))))))))))........)))))..)))........)))))))..............(((..(.((.((((((.................))))))..)))..)))(((.((((...........))))))))).)))).))))..))...))).)).))))))).))))))))...((((((.............)))))).(((((((.((((...((((((((....(((((((.....))))))).(((((.(....((((((((...(((((((((((...............))))..(((.....))).....(((((((((.((((.(((((((((.....((((((.........))))))..................((....)).......((((((..........))))))(((((((......((((((..........)))))).......)))))))..........(((((((.(...).)).)))))..................(((.....))))))))))))...((((((((((...(((((((((((((((.((((......)))).((((.(((.(.((((.((((......))))..))))).)))))))..)))))..(((((((((...........(((((...)))))..........)))))))))(((..(((((((.((((..(((((((.....((((.((((((((((.(..((((....)))).............((((.(((.....))))))).....((.(((.((((((..........)).)))).))).))......((((((..((((((((((((.(((((((..((((((((..((((..((((((....(((((((((((((((((((((.((.........)).))))))))....((((.(((((((((((..((((.((..(((((......(((((...)))))((((((.........)))))).((((((....(((..(((.....))).((....((((((.((((((........(((((((((((((......((((..(((..((.........))..)))..))))))))))).))))))...........((((..(..............)..)))).(((((.....)))))............)))...))).))))))......)).(((((....(((.((....((..(.(((((..(((((((...)))))))((((((....))))))............((((((((.((((((...((.((.....)).))..........(((((...(((..........(((((((.....)))).)))(((((..(((((((.(((((((....((((((((((((((((......((((((((.....)))))..)))..)))).))))))))))))((((((.........((((.....))))............))))))...((((((..........((((..(((((.....((((((((((....((((((...(((((.((((..((...((((.(.((......))).)))).))..)))).))))).))))))...((((..........))))(((.(((......))).))).))))))))))....(((......))).......(((((.(((.........(((.(((((((..((((((.(((((((........)))))))...........((((......)))).......((((...))))))))))...))))))).))).......)))...))))))))))..)))).))))))....(((((..........))))))))))))....))))))).))))).....))).....)))))))))))))))))))...((((((.((..((((.((((((.....(((.....((((((((.......))).))))).......((((((.....))))))......((((...(((((...)))))..)))).........((..(((.(((((((...((((..((..(((((((.(..(((.......(((((.(((....(((.....))).)).).))))))))..).))).)))).....)).))))))))))))))..)))))((((((((.......)))))).)).....)))))).))))..))........))))))....))))))..)).....((((..((((((.((((......))))...))))))))))((.(((...........))).))..)))))......)))))......)))....))))))...........((((((((((((((((.((.((((((...(((.(((.(((.((((((....)).)))).)))))).)))...((((((((...........(((((....)))))..))))))))...(((((.....))))).......))))).).)).)))))............((((...))))...)))))))))))..)))))..)).)))).(((..(((((((.......)))))))..)))................))))))))).))...)))).))))))).......))))))))))))))))..))))).......)))....)))))))..(((((.(((((.....))))).))))).....((((((((....(((((.........)))))(((.((((((.((((.......)))))))))))))....)))))))).(((((((((..(((((((.((((..((((.(((....(((((...(((((((....).))))))...))))).)))))))..)))).))))))).))))))))))))..)))))))))..))))))..............(((((((((((((.................))))))).)))))).....).))))))))))))))....)))))))....))))))))))).))).((((((((((....))))))))))..((.((((((...)))))).))))))))))))..(((.(((((......))))).))))))))))))).....)))).)))))))))...)))))))..))))))))....).))))))).)))))).(((......))).....)))))))))))..........)))))..))))))......
Thermodynamic Ensemble Prediction
{(((((((((((.,,,(((..((((((((((((.((((((((({...})))))....))))))))))))),..)))),))).,...(((((((((.{.....(((((((((((((.,(.(((((.(((((((((.....((((..............)))).....)))))))))..))))),)..),,)))...,..(((((((((.,..((((((((..{{....)})))))))),.))).))))))..|...((,.....,.....(((((....((((((((((((....)).}).)))))))))))))...........},,..,|||)))))))).....},)))))))))..(((....)))....(((({...}))))((..((((((,..{((({.((((((.((.......)).)))))).,||,((((.......)))))}}.......{({.(((((.(.(((((,((..(((((....................))))).|{((((((((((((((.....{{{((({..(((((((((((((..{{.(((((((((((((...((((.((({(...{{(({((((.((((,............,..,{{,,....{,,,,,,........{((((.((((((({{{(.((((((((((({..((((((.,.((((.(((....)))..............(({{((((....)))))))..(((((.((((((.(((.(((((((((...,(((((((.(..((...((..(((((((((((.((.(((.(((...((((,.((((,.{..{{{||{|,|,,.,,.((((.((((((((((((((.{((,...||},((((.....)))){{....}}}{((((((((((((((((({......(((....})).{(((..{((..(((({,...{,,(,.(((((((((((...)))).)))))))..}..,|,,,|,((((({{{((((((((.(((......,{{{(.,.,{{{{{{|||{{{,..........,{{{{((((,,((..((((,{..,.............,,|{,,||}},,|||{{{,.,,{(({{,....||{|.{{{{...,))))..........}}}}.,,..}},,,.........{||||{..{{..,,((((.,{,..{{.,.(((((((.,.((((...,{{{{..,,,|||,,{{,,||,..{|||{||},.......,{{.,,....||},}}.....})),,))}||{.,,|,,,..,}))}}...))))..}.)))))))||,..|,,,.......,,..........((((((((....)))))))).(((((..((((((((((((((.....)))}....,.,{((.({((({{.,,((({.(((((..,,,,|||||(((((((((........((((((((....(((..((({{.,(((......}}}..)))))..{{{....|||.,.......|||,,..,.))),..)))...))))))))...((({.{..{(......,))..})))).((((((((..,..(((((((((((((((((......{{{..(((((........)))))....,|,.(((((.((.....))))))).,{((((((.......)))))),)),..((((((......))))))...,,,{{(,.....((((((.............)))))}.....||}},,,,...)))))))......))))).............))))).......)))))))).(((((.....)))))))))))))))))).})))))}...}}|.,{.((.,((((((.....{{{,,......,,)))))))}}.,.{{{...{{((((,,..}}})))..,},,..{,,,....|,,||,,,.}||||.{{{{,|,||{{.((((({{{,....................,,,,..((((....)))),|||||(((((,.....{{...,}},.....,))))}}}}}.|}.}...})}}..}}}}....||{.,.}}}}...........}})}}}..}||,}|}}..{{{.,,,,.........})}.,.....,,||,,,,,,},))))))))))..))))),,,..,....})),..)})}}}|||{,,,.((((((((......,,..,,..,..}},.))))))))..............|(((((.....)))))}.((((((...(((((((((((.,{........}}.{,,,......,,,....(((((((..(((,{({(((((((.....,.)))))))}),))).)))))))..,))).(((..((((..((......)).))))..)))((((((...{{,...,)).))))))....)))))),}))))...))))))....}|||,,{..((((((((((((({.......}.))))))))))))).))))))})))))))).}}.{{(((({,,{{,((((((((((.{{.......{((.|,..||},,,....))}}}}},,)))))))))}.|{(((({{{{{{||,{||....,}},......|||||,},}}}}},,...,,}}}}},||||}}}||,.|||||}|}.|||({((,.......{|,|||||..((((((....)))).))...))}||,}},,...||,...||||............)))).,},..(((({((.,,.,...,...))))))).(((((......)))))(((((..{(((((.(((.({((((.(((((.....))))))))).}).))).))},))))))))(((((....))))).....,.,}}}).,})))),,,}}},}.,}}.....}),.)))))){(((,((((((.........,{{.......,,,.))))))..,)))}}...((((((.((.(((((.(((((..........)))))...)))))...)))))))).((((((((((.......)))))))},)).....))).)))))))).})))))),|{{(({{..........)))))),....}}})..)))..})))..}))))))))))))))....)))}.......))))))))))........,{...(((((....)))))...}}....,,........((((((((.,{((((((((,,({{{{..{{.....,,,...,,.}},}}}}.,,...........,(((,{{......,{{.{(((((...)))))),)))}}}...,,..}})})..)))))))))))))))))....)))).))))....(((......))).,{{{..,{(({.......,..}))))..},,,.||,||.,})))))..,..))))..))))...))).))).))))))).).)))))..))..(((((.(((((((......)))).............))).)))))))..))))))))|(((((((.,....,.)).))))),.)))))}.................(((((((((.(((((..{{,{..,,{..,,.....(((((..{(((..({{.,,{.......,...,))}..})))...)))))..{{..,,.)}.,||||,|,........}|}|,||{{{,,,..,........}}},...,))).((((((((((((((((......((((((.(((((((((.((((((((.....))))},)))..)))))).))))))))}......}}..)))))))))}..(((.,..((((...(.(((((((..((((((......(((((((.((((...((((({,.,{,..,,,{({|{.|,,.,,,,|{({{......}}.})))}.,....,.((.(((((({.,(((.........)))))))))).))))))...))))))).....(((.....)))..,{(,(.((((((((,,((((({{...............((((.....)))}|}||,.....{(({{.,,{(,((((((((.....({{{....}}},.((((.(((({...})),}).))))......{{{((((..(((((.....{((,.....(((((.....))))}.......{{{{...,.....,,..}}}}.((((((((((((.(((((.(((.......))).))))))))|((,.(((((((.....)))))))..,}..}.,}((((((((((((((((..{(((.((((((((((.{{,,,,{{,.(((((.{({{,|{{..{{(((,{((...((((,{((,..||}.}}}}.,,|},.})))}.}}},..,,..((({{........)))}}.,,.,,.,},.{((({{{{.((((((........)))))).(({{....{((((((......((((((((....))))))))))))))}..})))((((((((((,{(((..||{(((.{||{.((((|{{(,((({{({,,,{{|,}})))})),))})))},,,.(((((((((((...{{,.|((((.((((((((,.,,.((,(((,(({,,((((({.,...,((((((({{(,,,,,{{{((((,,.,|||||||||,,,..))))))))))||||},,),}}..((((((((.,(((((((......{{{({{{(...,}})}}||}.....,)))||||,{{.....{{{(((((((,,.....))))))).))),,||.((((((({{{{(({,{||||....,|.}}|((((((.((....(((..........)))....)).))))))|.{,.............|||,.||||||}}||{,{,..((((((((........))))))))|((((........))))}..((((((,....,,.....}}}},,||{,..||||{||{{,...,((((((((({{{(({....((((((((............(((((.....))))).(((((((((({,((......))))))))).)))){{{{(({{{{,,((({((((((((((..(((((((.........)))))))..))))))))}..,..|||||{{|||,..{{....{,.,,,.||||,,....,.,.,...{{{{{.{{.....}).))))),{{{||,.}})})},....,}|||,|,,},,,((({{|......}}})}}...,(((((((..(((((((.(((,...((((..((((((,.((((((((....)))))))).,,......,.((((((((((({.........,}}{((((({(((((((.....))))))),(,((,,..{(((((((({.,((((({{(,{,((((((((((((((....)))))))...))))))),{(((,,{{,...}}}...}}}|,..((((((....))))))..||.(((((((((((.{{,,,{|,{{{|.....,|{|...,{{{{{||...,,...,.......||||,}},....|(((...,.,.))}|{{.{,.,,..},,}|.........((((((((.((((((((.......(((((((..(((,,{...{,....}}.{{{||,,|,(((((((......))))))),,..,,}}..((((((((((((....)))))...))))))),}}.)))))))))))))))....)))))))).......}}))))))))))),{{|||}}},),,}}}.}})}}})}}..,..||(((.|..,,,.,.,||}||}}},,},,....},)))}}..}}}}}))))),,,}).}}.||{.,}.,,.)))..,.))))))},.)))))))))).|,{((((.{((((((...,,..||||||,},}}}}}....(((((((((...,..........))))))))),,{{{....}}}.}|||||,}|}}}}})||{|},|,,...,,,}))){{{{{.,..,|.({{,...,)))........})))}))))))).))))))))}},},.....,..((((,...(((....((((((......))}}}))..)))))))).,,.((((((.({..(((((((((((.(((((((...........)))))))..))))).))))))}).)))))).))))))}}..}}}...,)))))))))))}....|}|||,||{((({{....||,|||{{{,,,..{{((,,,}}}}...|||||},|{{....))),,)))))...{{......,,,........,}))))))},}),.)))}...((((.(((((((((({.(((...(((.....)))...))).,..))))....))))}}).)))).))))))))...}}}}}}.}))))),)}}))))))))))))))))))))))))}..|||.{{.(((..(((..(((((((((((.(,...(((((.(((((....)))))........{,.((({({{(((({,.....{{,.......,},,.}}|........|||.(((((,,......}}},,..|||},..})}},.}))).)})))}}}...........))))),,,,.))))))))))).....)))...))).}}.}}}....||||.............,,||||.}.))))}..))))))))))))))...((((((((((......))))))))))........}}|||||}..................,...}}}}}||}}|.,,..}.),,.)))))))))))))}........{((......})}...)))))...))))))))))).....,{{.,..}}}..{(({(...(((((...))))}....}}}}}...((.((({.(((((((.......))))))).})))..))..........))))))))),{,......|||....,,.,,....,.}}..,.,{.((((((....{,,...,}}....))))))..)))..)))))..)))).)}}.......)))),)))))).)}}}}...))))))))...))).,,,)))))).((((((((...((((....(((((.{{{({....|||.(((((((((((((........,(((((((.....))))))).,.........{((...}}||.(((....)))}}.....,,..((((((((((((({{,,,,,|||,((((((((((((,({{{{(((((({.{{.....((((((.........))))))..........,.......{{..,,)).,}}}))}||{{{,.......,.,,}||.(((((((......((((((..........)))))).....,.)))))))..,,.......,{{{(({({,{{{||.,,)))}................,(((.....}}},)))))))|.{{{{....,,........((((...))))...,{,,|||..{(({.(((((((......{.((((((({.{(((......(((({||{(||..((((((...)))))).{{(((({(...}}))))}}....((((((((...((((({{.(((........)))}}.)))...))...)))))))).....(((......}))|))}}}))))....)))}.))))))))|....(((((.,.,.(((((..(((((....((.((((((.(((.....((((((..{((({...,,,...{{{{,,...,}}..}}}}....(((((........))))).)))).)..))))))..))))))))).)))))))..))))).,.))))),{|{((((....}}},}|,.......,.{||{...((((((({...(((({...})))))))))))}..}}}}...,....})))))).,}}}.,,|||,.||||||{||,...((((((.{{{(((........((((((((((((({.....,((({{({{..,,.........)).,))),.},,)))))))).))))))...........((((..(.........,}...}..)))).(((((.....)))))............)))...))}.)))))}(((((.((.((((.........{{....{{{{,,{,,{...(((((((...)))))))|..|}))}}...,)).........)))).)))))))||{(((,.......,,,,.,|||||..,,.....}}}}},),,.,{,,..,...,,|,((({...,|,,}..((((((((((......))))}})))))...||||{{|||||{{{{,.....,((((((((.....))))}.,))).))})),)))))))))}}}..,{,........|,,{{(,,,..,}}}......||}...})|}||...{{{{{,..........((((..(((({..,..(((((((((({...((((((...(((((.((((..((...((((.{.((......))..)))).))..)))).))))).))))))...,{{{...,,,,...))))}{(.(((......))).})),})))))))))....|{,.....{|..{{{,...})))..}}.......{(((((,{(((.....(((((....}}))})))))))))){||...,,,.......,|{{,,....,})),..,{{,((({...{{((({.{||...))),)))))),..})),,))}.....,,,)))))..)))),))))))}).,|||||,}},,}}}),))))).}}}}..)))))))))))).,|,......))))))).)))))).........(((((......)))))..{(((.((((((....{(((.,..,(((((,((.......)))})))))}}},,..((((((,,...,,,}},.,}}}}||.{||.{{,({(,..|||},,}},}.,,,..}.,((..(((.(((((((...((((..((..(((((((.{..(((.......(((((,,{(,...,,{.,.,,)}}.},.}.,})}},))..}.))).))))..,..}}.))))))))))))))..)),},{{{{{{({.......)))))).)),.,..)))))).)))|{.{{,,,{,...}))))),),)}.)))))........((((..((((((.((((......))))...)))))})))),}.)))))))))))))))))))).,.)))).....,.}}}......,))))))..))))).))).))))))((((((((((((((((.((.((((((.{.(((.(((.(((.((((((....)).)))).))))))}))}...{(((((((,,{..{,....(((((....)))))..))))))))...(((((.....))))).......))))).).)).)))))............((((...))))...))))))))))).,)))..))).)))))).)))))((((({.......}))))).....))))...))))))....)}))))))))).,|}}}....,,...........))))))).))))}.....(((((.(((((((............))))))).)))))...{(((((.{,....,,.)))))},})}|,...,|||},........}}||{(((.((((((.((((.....,.)))))))))))))}..,.,,..(((((((((.((((..((((.((((((...,{,.((((((.,{((((,.,,,{{{({..(((((((((.(((.......))).})))))))).,,,..}}}}},.,,..,,,,.}))))..))))))..}},...))))))})))..)))).)))))))))..)),...,,,{((((((((((((((((((((.,.........))))))))....((((((,.((....)).,..)))))).))),.,)))))))))))))))))})))....}}.))).)))).))))))))}.......(((((...})))).})))),.}}.)))).))))))))).}},))))})...)))))))).)))))}},}.....},))))).).))))).)))}}))}.})))))..)){{((((.,..}}}))}.,,.)))))..))))))}}....

Transcripts

ID Sequence Length GC content
AGAAGCGGGCGAAUUGGGCACCGGUGGCGGCUGCGGGCAGUUUGAAUUA… 10290 nt 0.4084
Summary

This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]

Forensic Context

A study in Sprague-Dawley rats demonstrated that the CENPF gene, identified as a differentially expressed hub gene present in multiple index sets (A, B, and C), is involved in ventricular system development and regulation of muscle tissue development following skeletal muscle contusion [Ren et al. DOI:10.1016/j.fsigen.2022.102722]. Separately, research in human keratinocytes showed that the CENPF was downregulated (0.25-fold) 3 hours after X-ray irradiation, identifying it as a radiation-responsive gene associated with skin injury [Koike et al. DOI:10.1269/jrr.46.173].