Basic Information

Symbol
CEP290
RNA class
mRNA
Alias
Centrosomal Protein 290 NPHP6 BBS14 CT87 Cancer/Testis Antigen 87 KIAA0373 3H11Ag JBTS5 SLSN6 LCA10 Rd16 MKS4 POC3 Bardet-Biedl Syndrome 14 Protein Centrosomal Protein Of 290 KDa Centrosomal Protein 290kDa Meckel Syndrome, Type 4 Tumor Antigen Se2-2 Nephrocystin-6 FLJ13615 POC3 Centriolar Protein Homolog (Chlamydomonas) Monoclonal Antibody 3H11 Antigen POC3 Centriolar Protein Homolog Prostate Cancer Antigen T21 Bardet-Biedl Syndrome 14 CTCL Tumor Antigen Se2-2 Joubert Syndrome 5 Nephrocytsin-6 Cep290
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_025114.4
Sequence length
7824.0 nt
GC content
0.3561

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1683.99 kcal/mol
Thermodynamic ensemble
Free energy: -1838.05 kcal/mol
Frequency: 0.0000
Diversity: 2143.03
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((...((((((((.((.((...(((.(((((((.((((((((.(..(((((.(((.((.((.(((((((.((((((((((.(.(.(((((.((..((..(((((....))))).)).))))))))))))))))))).))))))).)))))))..)))))..).)).)))))).))))((..(((((((((((.......((((....)))).....))))))........)))))..)).............)))))).....)).)).)))))))).)))).((((((((..(((((((.(((((((.((((((((...(((...((((.(((....(((((((.........(((...))))))))))...)))))))...)))............(((((........))))).))))))))..)))..))))..((((........).))).....((((...))))...........(((......)))..........(((.((((.((...)).)))).)))(((((((((...))))...))))).)))))))))))))))..(((((((..............((((.....((((.(((.....((..(((((((..(((((.......((((((((((((....((.((((((.....)))))).))..........................((((........(((........)))........))))(((((.......))))).....((((((((..........(((((.....)))))....(((((.(((((((((((.((((.....(((.((((..........)))).)))............((((..(.(..((((((((((..(((((((........(((((....((((...........))))....))))).......(((((((......(((((..(((((((((((..((((((((........))))))))))))))(((.....)))....((((.(((..........))))))).)))))..))))).))))))).(((((.((((((((.....(((((((((((((.......((((....(((....((((....((....(((((((.(((((.....))))))))))))....))((((.((((((...((((((((...(((.(((...((.(((......))).)).)))...)))....))))))))..)))))).))))...(((((((((((((.(((((...((((((((((((((((..((((((.((((.(((((....((((((((((...................))))).)))))...))))).....(((.(((...(((.........((((((((((((((((...................((((((....((((...((((....))))...))))...)))))).....(((((.....))))).(((....))).))).)))))...........)))))))))))...))).)))............)))))))))).)))))).).....)))))).)))..........)))))...))).......((((...((((....))))....))))....((((((((((.....(((......))).....)))))))))).........((((......((((((..(((((((((....((...((((((..(.((((..((((.(((((((((((((..............((((........)))).......(((((((((((.......((((((.((((........(.(.(((((..(((........)))))))).).)(((......)))......(((((...))))).........(((((....((((..(((..(((((....(((((.....((.(((......(((((((((.(((..(((((((.((((((......))))....)).)))).)))...))).)))))))))......))).)).....)))))....)))))..)))..)))).)))))((((((...((((.((...((((((.....))))))..............((((.....)))).............((((..............))))......((((........))))(((((....))))).....((((((((((((......((((....))))....((((((((.(.(....).).)))))))).....(((.(((((.....((.(((((....)))))...))...))))).))).......)))).))).)))))...)).))))..))))))..............(((((((....)))))))..(((((.....)))))..........)))).))))))......)))))))))))...)))))))))))))....(((((((.(((..((((...((((......))))((((.((((((.(((((........(((((((..((((((((((((........................(((((((((((...))))))).)))).(((((((.((((...)))).))))))).(((((((((...((((((((.(((.(((....(((((((.....(((.((((((...((((.....(((((......(((((((.((((..((((((...)))))).....((((((((......(((...((((...(((((((.(((..((((((((...((((((((((((............((((((((((..(((((((.....)))))))))))))))))..(((....)))...................(((((((....(((((((((...(((((............(((((.......((((((((((((..((((((((((((((((((((((...(((.(((((.(..........).))))).)))))))))....(((((((........)))))))..((((((((((((.(((((((...(((......))).....))).)))).)))((((((....))).)))....(((((.....)))))....(((((((((...)))))))))(((((........(((((((....))).)))).........)))))(((((((................))))).))(((......))).)))))))))......((((....))))...........((((((((.((((((........((((((((((((............((((((((((((((.(((((((...........((((........................)))).......(((((.......)))))........(((((..(((((((......)))))))...)))))))))))).)))))))((...(((((..((((((....(((((((((..(.(((.....))).).)))))(((((........)))))))))...))))))..)))))....)).((((....))))..((.(((((...(((........)))..))))))).........)))))))...........)))))))....)))))........(((((..(((((((..................(((((...........)))))))))))).))))))))))).((((((((...)))))))).........))))))))..((((...))))......(((((((((((.(((((((((((.(((((((..((((((((..(((.....(((((..........)))))..)))...))))))))....)))))))...(((.......)))....))).)))......))))).)))))))).)))..((((........))))...)))))..))))))))))).)))))))))))).....)))))...((((......))))....((((((((.....(((.(((.....................................................)))))).......)))))))).........((..(((((...(((((..(((((((.((((.(((....))).))))..)))...(((...(((((.....)))..))...)))...................(((.(((((((((.((.........((((((((((((...(((((..............))))).....)).))))))))))...(((........)))..))))))))))).))).((((((..((......(((((((.......(((...(((((((((.((((.......)))))))))...))))......((....))...)))......)))))))......))..)))))).(((((....))))).((((.......)))).))))))))).....)))))..))...))))).))))))))).....)))))))....)))))))))..((((((........(((...)))......)))))).....................((((((........))))))...........((((....)))).(((((((((((.....((((.......))))....((((...........((((((....))))))..))))....(((((.........)))))......))))))...))))).....((((.((((..........)))))))).........((((((.((...............)).))))))........)))..))))))))..))))))))))((((((..((((((.....)))))).))))))...........((((((........)))))).....................((..(((((...............)))))..)).)))).))).....))))))))..((((((..(((...((.......))....)))....)))))).))))))))))).(((((.(((...(((((...............)))))...))).))))).....(((........))).....(((((((.....))))))).((.(((((.(.....).))))).))..((((...........((((...((((((((.......))))))))..)).))...........))))..)))))....))))...))))))))).....(((.....))).....((((..(((((((...((....))..))))...((((((........)))))))))..)))).............)))))))..((((.(((((.((.......((((((((((((((....)))).........))))))))))......)).)))))..)))).)))...))).)))))))).)))))).)))......(((.(((.............((((((((......)))))))).............))).)))................(((....))).....))).))))..)))))..))))))).................(((....(((........................)))...))).....)))))))))))))))...............(((((.........(((.(((((.....)))))...))).........)))))...........)))).))).)))))))............((((((.....((....(((((...(((..((((((((((..............(((.(((((((..((..((..((.((.....((((((((((((....)))......((((.((((((.....((((((.(..(((((........))))).))))))).......)))))).)))).......)))))))))....)).)).))..))..))).))))))).((....)).....((((.(......).))))...))))))))))..)))...)))))...))........))))))...........((((....))))...)))).)))).)..))))))...)))))))))))...))))))))))......))))))))))...(((((.(((((....(((((.((((.......((((((.((((((.(((((....)))))..(((((....)))))((((....((((((((.((((...(((((((((..((((........)))).(((((((..((.....))))))))))))))))))...))))...))))))))...))))......((((((....)))))).............(((((((...)))))))(((((((......))))))).........))))))))))))..((.((...)).)).......)))))))))))))).)))))..))))...)))....))))..(((((...))))).............(((((((...(((((.............((((((....(((((((((((((((..((((..........((((..(((.(((.....(((.....)))....))).)))................((.(((..(((((((((((((....(..((((((.((.........((((..((.....))..))))..........)).))))))..)..))))........)))))))))..))))).........))))..........)))).))))))...........((.(((((..(((((......)))))....))))))).(((((.....)))))(((((.((((........))))....((((((((.(((...(((((((((((....(((((......((((..........))))....((((.((.......)).))))..)))))..))))).......((((.......))))...........(((.....))).......))))))((((.(((((........)))))..))))......(((((((((((((((.......)))...)))))...)))))))))).))))))))..((((((..(((((.(.(((((.((............)).))))).).))).))))))))...)))))...((((.(((...))).)))).)))))))))..))))))..................((((((...(((........)))....))))))....((((.(((..............))).)))).........)))))...))))))).))))))))))))).......)))))))))))))...............(((.(((........))).)))......((((((......))))))....((((.((((((((...)))))..))).))))..))))))).))))))))))..).)..)))).)))))))))...)))))).))).))..(((...)))......)))))))).........))))))))))))..((((.......))))(((((((.(((((((...)))))))..))))))))))))))).))))...))......))).)))).....)))).((((......))))......)))))))....
Thermodynamic Ensemble Prediction
.{(((,..((((((((.((.((,..(((.(((((((.((((((((.(..{((((.(({{((.((.(((((((.((((((((((.{.(.(((((.((..((..(((((....))))).)).))))))))})))))))))).))))))).))))))).})))))..,.)).)))))).)))){{..(((((((((((..{{...((({....))))...}}))))))........)))))..}}.............)))))).....)).)).)))))))).}}}..((((((((..(((((({,(((((,,.{({{{{{{}},|||...{{{{,{,{...,(({{,{({........||,...)))})))))}...}}}}}}|.{,|||......,.,,..(((((........))))).|||||}},.,))),.......((((........),})).....{(({...}))}.,.........{{{......})),,,.......(((.((((.((...)).)))).))){{{{{((((...)))).,,}}))}.}}}}}}}))))))))..{{,,,,..,...,,,............{{{,,{({(((({{{.{,...((((({.{((({,.......((((((((((({...,((.((((((,...,)))))).)),.,,{{{,,..,,,............{{{{.......,|||........}|,.,,.....}}}}(({((,......}|}}}.....{{,.,.....|.|||...{{{{{.....|||||....{{{{{.(((((((((((.((((...,.(((.((((..........)))).))).,..........((((.,{.{..((((((((((..(((((((,,,,,.....|||,,.,({({,..{{...,,,|,,......}}}}....||.{(((({{..,,..{{{{{..{,((,((((((..((((((((........)))))))))))))),||..,..||}....((((.(((..........)))))))})))))..}))),.|}||}||.{{{|{,((((((((.....(((((((((((((,,,{{..((((.,,.{{{,,{(({({..,,{.....{(((((,.{{(({..,,.}}}||)))))}}..,,{}||||.||||{{..,((((((({...{{{.{,,..,{(,(({......))),,}.|||.{{|||....})))))},..,|||||{|,},..{(((((((((((((....{{{,.{{,{{{{{{{{{{{{{.,({((((.{{{{.(((((....((((((((({......,.........,.,))))),,))))...))))).....|||,|{{...,,,......{{,(((((({{((((((((..,,,.,{{...,}....,((((((....((((...((((....,})),..))))...))))))}....(((((....,))))).(((....))).})),,,,)}........,,.)))}})))}}}...))).}}}......,.....))}))}))}}.}}}}}}.,,..,|}))})),||,..........|||,....,,.........,{,...((((....))))....,,}}..,.((((((((((.....(((......))).....))))))))))..,.....|{{{|..,,,.((((((..(((((((((....,,...((((((.,(.((((..((({.,{{{{{{{{{{{(,,,,,,........((((........)))).......((((((((({{...,(((({.,{((({{{,,,,....,,,,|||||||{{{........}}}|||...,{{({(,,,,..|||,,,...({{((...|||||{({.,,...{{(({,,..((((..(((..(((((....(((((.....{{.(((......(((((((((.((,..((({(((,((((((......})))....)).}}}),)),,,,),),)))))))))......))).)).....)))))....)))))..)))..)))).}}}}}{{{(({...{(((,{,...,,{{,,.....}}||||,...........|||{{{.....,}||,,........,.}|||,.,{,.,,.......))),......{(((........)))}(((((....))))).....((((((((((((......((((....)))}..,.((((((((.(.(....).).)))))))).,.,.|{|.(((((.....((.(((({....}))))...})...))))).,}}.,.....)))).))).))))).,|||.,,,,}})|||},.......,,...,.{((((((....))))))}...,,,,....,|||||{...,,|,.,||,|||}}}}.,,.,..|||||}||||},,,||||}}}}}}},|{{{{{{{.,,{,{,.(((((.......))))).,|||{{{((,{(({{,{((({{.,,,{||,{,,,,,{..,,{{|{{||,{{|,|||,,.................,,..(((((({...})))))).||||.(((((((.((({...}))).))))))},,|||,(((({,.,,||||||.,,...{,....{{.((((....{((({((((.....|||,.{{{....,.......,,{,,..,,{,,..,((((.{{{|,,,))}}..}}}}.((((.....}}}}..........,{(((((.(((..((((((((...((({((((((((,...........{((((((({{,{(((((((.....))))))))))))))))}..{{,....})},,..,,,{{...,......(((((((...,(((((((((,..((({,.........,{,{{(((,......{{,{{{|||{||..(((((((((,{((((,((((((...(((.(((((.(..........).))))).)))))))))}}}}|,||||,}}}},...}}}}}},,.,,,,,,{{(((({((((((...{{{{.((((.........)))).,......((((((....))).))),,.,(((((.....)))))....(((((((((...)))))))))(((((........(((((((....))).)))).........))))),,,|{{{............,|{{|,|||,||,,{......,}||||,||,,}}......((((....)))).........,,||||||...|||||,.|}}...,||||||||||||..,...,..{{{((({{(((((((((.(((((({..........{((((........................))))}||,...{{{{{.,,....}}}}}.....,..(((((..(((((((......)))))))...)))))))))))).))))))),,...|||||,.(({({({{..{{{{{{{((..,.(((.....))).,.)))))(((((........)))))}))).}}))))))..|||||{.{{{{,((((....}}),.|{,.(((((,.,{{|.,...,,,||...,,,||{{...,|||,.,||||||,.,,|..{{..|||||||{...,,||)|,,,.....,|{{.,,|||||..,||||,,,..|,.(((((((((...........)))))).))).}||,,,}}},,|{{((((((((...)))))))}...,)))}}||||||||.,{|{{,|{{..,.....{(((({((({,...|||,|||||,.(((((((.,((((((((..({(.....(((((..........)))))..))},..)))))))).,..)))))))...{((.......}}}..{{|||{||,,....{(((({{{{.,.......)}}}.))))}...{{|||}{{{|||,,..,,,||,|||||{|||,,,,))),,}}}}}))),,...{|||,,....}}}}....((((((((.....,{{.{((..........,}...................{{{,.,......}}}}......}}}}}}.......))))))))......,,|,|}}}|,......,,,,..|||||||}{(((.(({....})).))))..,||...((,..,|,{{|,....)))..,),,})))},,||,.............{((.(((((((({,({.........(((((((((((({{,{,,,,..............,,)))}....,}.))))))))))...{({........}}}..})))))))))).))}.||||||..{|.....,|||||||...,...,,|...|||{{{{{(,(({,....,{{||||,,|||{,.||,|{{{{(.,..,||||.,,|||,.,...,}}},,,......))}}))}))).(((((....))))).((((.......)))).,,)))))),}}...)))))..))}}}))}}),))}))))}}.....}}}}}}}....)))))}}}),,|||||||,...,|.||,.,,}}),..,,.}|,|,.......,,.............((((((........))))))........,,,((((....)))).,|||,{{{||{.,,|||||{....,}}))||(((.((.,....,,,,...((((({....)))))).)))}}....(((((.........)))))......}}}}},...}}}})}.,,.((((.((((......,,..)))))))).........{{{{{{.((,,,.....,,,,...,}.)))))).,,.....)))..))))))))..))))))))||((((((..((((((.....)))))).)))))),,.....{{{{((,((,(({{{{{.},|||,..............,}}...}}}}))}|},}))},}......))))))))}}}))))))))...}}},}}))))}}}}|}|||||,{||...||,...}},))}}..),}..}}})})}}|}}}||}}})}}.,{((|||||..,((,,,...,}}...,}..,,}||}}...}}}.,}}},...||(((........}}}.....(((((((.....))))))).{{.(((((.(.....}.))))).})..||||...........{{{{...{{{{{{{{.......}))))))),,)),})}...,,,,}}}))},,})))))....||||..{|||||(((|.....({{.....}}}.....((((,.,..(({(.,,{{....||{,||}}...((((....})))..||,}||||,..||||.............|||||||,,((((.(((((,((,......((((((((((((((....)))).........))))))))))...,,,),.}}))),,)))).,||{..|{{(((|{|..|.})))||,|}}.,..,.|||.(((...........,.((((((((......))))))))......}}.....))),|||.....,}}|.......(((....))).....,},.|.||{{||.,,..))))))..,...,,......,.........,|{{...........,||...,.....,}}....}},|}}|.}},,,))})))))},...,}}}.........||||,...,}||.{||.(((((.....)))))...,,|.........,}|||..,,...,..||||{|||}..||||....,))),,,...{{.,}}...,,....,,)}}}}...(((..((((((((({.,{(..{,.....{((({(,,,,,,......,,.,{({({{{{,,(((,,{{{{(({....}},.....,(((,.((((((.....((({{{{(..(((((........))))).))))))).......)))))).)))).....,}))))))}))....)).,}.,|,.,...}}}.))))}},.,|....}}.....,,.,}}))}}..},.))..)}))))))))))..)))}}}))))))))))}},.....,|||.....,,}}....{(((....))))...)))}.}))),),.))))))...),)))))))))...))))))))),...))))))))))))}.,....}}}|||}}....,|||,.{||{{,,,,..,,{{{|.{{((({.((({,....})))),,,||||,|,,,||||{{(({{,,((((((((.((((...(((((((((,.{((({.....,.}))}.(((((((,.{{.....))))))))))))))))))...))))...)))))))},,.|||||,....((((((....))))))...,.........{((((((...))))))),||||||.|,|,.,||||||....,}}}}},})))})))))}}||.|,..,||||||.,.}}.}}}}}|||||,,},.|||,...,}),.,,))},,.,||||..,{{{(,,,|}|||.........,.,|||{{{,,...|||||.............((((((....((((((((({{{{((,.((({,.......},||||,,||{.{((.....,,{.....}}}....})).}}},,,......,...,},||.(((,.((((((((((|{{..,.{..((((((.((.........((((..,,.....,}..))))..........)).))))))..,..|||........}))))))))).,)}},,.......,.}}))........,,|||}.,,}}))...,....,..|,.((((({.{{{{{....,,)))||,,....)))),.{((((.....)))}}(((((.((((........)))).((((((..(((|{....,|{,{,(((((,{,..,{{{{..,..,||{{.,,.......}))}....,,||.||.,,,......,}},.,)),))}})).,|,,.....((((.......))))......,.,..{{{.....}}}.......,},,,,((((.(((((,.....|.|||||..,))),,....(((((((((((((((.......))),..)))))...)))))))}))})),)))).,.((((((..(((((.(.(((((.{,............}}.))))).).))).)})))))),..)))))...((((.(((...))).)))).)))))))))..))))))................,,((({(({{{(,,........)))},,.)))}}}....(({{.{{{..,,,.........,}},)))).........})))}..,)))),,}.))))))))))))).......))))))))}}}||{....|||...,....,||||,........||||||,...,},|||(((.....,||||||,,..((({.((({((({...}))))..))).))))..))))))).))))))))))..}.}..)}}}.))))))))}...)))))).}}}.,,..{||...}}}.,....,))))))))))).....,))))))))))}..{(((.......)))}{((((((.(((((((...)))))))..)))))))}))))})).))}))).)))))}..}}},|,||,,||}}}}}.|{,.......,},,.,},..})))))}....

Transcripts

ID Sequence Length GC content
AUUCUGGCCUUGGCGGAGUUGGGGAUGGUGUCGCCUAGCAGCCGCUGCC… 7824 nt 0.3561
Summary

This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that mutations in the CEP290 gene increase the risk of sepsis in patients with severe burn injuries, identifying it as a susceptibility gene for early warning of sepsis in this population [Huang et al. DOI:10.1093/burnst/tkac050].