| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGAAGGGAAUGUGACCAGGUCUAGGUCUGGAGUUUCAGCUUGGACACU… | 2476 nt | 0.5238 |
This gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. This cluster includes several genes involved in regulation of the immune reaction. Polymorphisms in this gene are associated with a reduced risk of age-related macular degeneration. The polyadenylation site of this gene is 421 bp from the 5' end of the gene for complement component 2. [provided by RefSeq, Jul 2008]
A study in human blood plasma demonstrated that the CFB was significantly downregulated with age and contributed to age-prediction models [Salignon et al. DOI:10.18632/aging.204787]. In a separate investigation of human and mouse serum exosomes during sepsis, the CFB was consistently decreased in septic patients, implicating its role in complement activation pathways associated with the disease [Li et al. DOI:10.1016/j.jare.2021.11.005].