Basic Information

Symbol
CFB
RNA class
mRNA
Alias
Complement Factor B Properdin Factor B H2-Bf BFD BF B-Factor, Properdin C3/C5 Convertase EC 3.4.21.47 Properdin B PBF2 GBG Glycine-Rich Beta-Glycoprotein Glycine-Rich Beta Glycoprotein C3 Proaccelerator C3 Proactivator EC 3.4.21 ARMD14 AHUS4 FBI12 CFAB CFBD FB
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Cause of death analysis

MANE select

Transcript ID
NM_001710.6
Sequence length
2476.0 nt
GC content
0.5238

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-857.10 kcal/mol
Thermodynamic ensemble
Free energy: -909.28 kcal/mol
Frequency: 0.0000
Diversity: 521.47
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((.((((((..((((((.(((((((.((((..((((((........))))))))))..((.......))(((((.......)))))..)))))))..((((((...(((((((((.......(((((.((.......)))))))((((((((((..((((....((((((((((((.....))))))..(((((........))))).((((...((((((...((((((((((((....)))))))).))))...)).))))....)))).....)))))))))))))))...)))))...((.(((.(((..(((((..((((((...(.(((((........))))).)..)))))).....))))).....)))))).)).(((.........))).)))))))))..((((((.((.((((((((((........((((((((((((.(((((........))))).))))...........((((((((((((((((.......((((((((.(((((((.((((..((((....((((.((((.........)))).)))).((.(((((.(((((..((.(.(((((......(((((((....)))))))......(((...((((((..(.....)..))))))..)))....((((.((.((((....(((((((.(((((((.((.(((((((.((.....))))))))).)).))).....))..)).))))))))))).)))))).))))).)))..)))))...))))).))..........))))...)))))))))))....((((((((.(((((.(((...(.(((((((.((..(((((((((.(((((..((.((((.(((((.....(((..(((......))).)))..)))))..))))...))..)))))..(((((.(.....).))))).)))))))))..))......((((...((((......((((((((((..(((....)))...((((((.(((.((((.....)))).)))...(((....)))...))))))....(((((...)))))......((((((...))))))(((....))).))))))).)))......))))..)))).((((((.((.......))))))))(.(((((((((..((((((..((((((((((((((..(((((((.......)))).(((((((((.(((((((........)))......((((((((((...((((((((....))).))).))....)))).))))))(((.........))).....((.(((((.....((((((.....))))))))))).)).........)))).).)))))))).....))).))))))))...))))))))))))......((...((((.((..(((((((((((.....(((..((((((.....))))))..)))........((....))))))))..........)))))..)).))))...)).))))))))).).))))))))...))).))))).))))))))((((.....)))).........))))))))....)))))))).))))))))(((....)))(((((.(.((((.......)))).).)))))((((.((..(((((((....)))))))..)))))).(((((((..(((((.............((((((((((((((((((((...(((.(((((((((((........)))))))..((((.............))))....((((..((((....))))..))))...........((((((.......((((........)))).......)))..)))...))))))).....))))))))..((((((((.((..((((((((((((((((((((((..((.((..(((.......)))..)).))((((..(((((.(...(((((.((((......)))))))))..).))).))...)))).....)).)))))))))...(((((..(((((........((((.((.......)).)))).......)))))..)).)))......)))))....))).)))...))...))))))))((((((.....)))))).......))))))))))))......((..(((((....)))))..))..)))))...)))))))...))))))))........(((((((...)))))))..))).)))))))))))))))......))))))(((...(((((....)))))...)))..))))))))))))...)).)))))........(((((.(((..((.((((((((.....((((((....)))))).....))))))))))..))).))))).(((((................)))))......
Thermodynamic Ensemble Prediction
.(((((((.((((((..((((((.(((((((.(({{,.((((((.,.....,)))))).))}..{{...,,..{,(((((.......))))),.)))))))..(((((({{,(((((((((.......(((((.((.......)))))))((((((((((..((((,...,(((((({{{{{.,,..|||||}({(..,.,},}....(((((((((,(((..{{(((((((......))))))).})))}))))))))).,||{||,.,,..))),),,.,)))))))))))))))}..}))))...{(.(({{(((.{(((((..((((((...{.(((((........))))).}..)))))).....))))).,...)))))).)}.(({.........))).)))))))))}}((((((.(,{((((((((((........((((((((((({.(((((........))))).})))...........{(((((((((((((((.......((((((((.(((((((.((((..((((.{({(((,.((,(,.,.{{{{.,,,,.)))).|,,|||{{,||||||,.,{,.{{{((....}}|||{|((,|..}}||}}}.....|||},.,))).{((((,..,((((((({{....||.(,.((({{((.((((....(((((((.(({{{((.((.(((((({,((.....))))))))).)).))}...}}},..)).))))))))))).)))))).})},.))))))))))))},||}}}.||..|,......})))...)))))))))))...{((((((((.(((((.{((...{.(((((((.((.,((({(((({.{{{((,,({.{||(,(((({.....(((..(((,.....))).)))..))))}..})||,,.}}..}}))}..(((((.(.....).))))).})))))))),.))......{(({...((((......((((((((((..{{{....,,,...((((((.,{(,(({{.....||||.,,,.|}||{....))),},))))))....((((,...,))))......((((((...))))))(((....))).))))))).)))......))))..)))}.((((((.{(.....,,,,)))))}{.(((((((((..(((((,.{((((((((((((((.,{{,((((.......)))).(((((((((.(((((((,...,,..||....,..((((((((((..,{(((((((....))).)))},).,..))))})))))),.|.,.......,||...,.||.|||,({{..(((((((.....)))))))..))}..........})))).).)))))))).....}}}.))))))))...))))))))))))....,{(({....,,..|}}|||({((({({.....(((..((((((.....))))))..)))..,{...{{{{,,,|,|||,||,.||||))),}},.....,...}).}})),))))))))).).)))))))).,.))).))))).))))))))|{{{.....}}}}.........)))))))),...)))))))}.)))))))|{{{....))))......(((((((..(((((((((,{{(,,(((({{(..(((((((....)))))))..)}|||..(((.....))}.}}}}})))}}..,..((((((((((((((((((((,{.(((.(((((((((((........)))))))..((((.............))))....{(((..((((....))))..))))....,......|||(((.,,.{,.((((........)))),,..,,.)))..,,,...))))))).,,..))))))))..{(((((((..,..{{{{({(((((((((((((({{..,,.,{.,((,,,,,...|||..}},||((((..(((((.{.,|||{{{.{{{{,,....)))))))))}.}.))).}}...}}))..|}})),,)))))))}...{{,((..(((((.,,.....((((.((.......)).)))).....,.)))))..)).||||...}}),,}},|.,|}}.}))|}}}}...))))))))((((({....,)))))),......)))))))))))).......,,.(((({....))))))))))))))..)))))))......)))))))).....,{.(((((((...)))))))}}))).)))))))))))))))......))))))(((...(((((....)))))...)))..))))))))))))...))}))))).....,.,(((((.((,..((.((((((((.....((((((....)))))).....))))))))))..})).)))))}|{{|{..|||........,,,,},}..,....

Transcripts

ID Sequence Length GC content
GGGAAGGGAAUGUGACCAGGUCUAGGUCUGGAGUUUCAGCUUGGACACU… 2476 nt 0.5238
Summary

This gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. This cluster includes several genes involved in regulation of the immune reaction. Polymorphisms in this gene are associated with a reduced risk of age-related macular degeneration. The polyadenylation site of this gene is 421 bp from the 5' end of the gene for complement component 2. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human blood plasma demonstrated that the CFB was significantly downregulated with age and contributed to age-prediction models [Salignon et al. DOI:10.18632/aging.204787]. In a separate investigation of human and mouse serum exosomes during sepsis, the CFB was consistently decreased in septic patients, implicating its role in complement activation pathways associated with the disease [Li et al. DOI:10.1016/j.jare.2021.11.005].