| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUCAGUCGGGUCCCGGCAGCGGCUGCAGCGCUCUCGUCUUCUGCGGCU… | 1245 nt | 0.5550 |
The protein encoded by this gene can polymerize and depolymerize F-actin and G-actin in a pH-dependent manner. Increased phosphorylation of this protein by LIM kinase aids in Rho-induced reorganization of the actin cytoskeleton. Cofilin is a widely distributed intracellular actin-modulating protein that binds and depolymerizes filamentous F-actin and inhibits the polymerization of monomeric G-actin in a pH-dependent manner. It is involved in the translocation of actin-cofilin complex from cytoplasm to nucleus.[supplied by OMIM, Apr 2004]
No relevant information is available at the moment.