Basic Information

Symbol
CHI3L1
RNA class
mRNA
Alias
Chitinase 3 Like 1 YKL40 YK-40 GP39 Chitinase 3-Like 1 (Cartilage Glycoprotein-39) Chitinase-3-Like Protein 1 Cartilage Glycoprotein 39 39 KDa Synovial Protein HCGP-39 CGP-39 YKL-40 GP-39 Cartilage Glycoprotein-39 HC-Gp39 HCGP-3P YYL-40 ASRT7
Location (GRCh38)
Forensic tag(s)
Wound age identification Other applications

MANE select

Transcript ID
NM_001276.4
Sequence length
1747.0 nt
GC content
0.5518

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-628.20 kcal/mol
Thermodynamic ensemble
Free energy: -660.35 kcal/mol
Frequency: 0.0000
Diversity: 450.28
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((.((((....))))...)))).)))(((((...((((((.((((.((..(((..((((......)))).)))..)))).(((((((..((.......(((((((((((((((((((((..(((((((......)))......(((((.((....)).)))))))))...)))))))))))..(((((((((((((((((((....((...((...(((((((.((((..((((((((((((..((((((........))))((((...))))......))..)))).))))))))........((((..((((..............((((........)))).((((......))))((.(((((.((((((((((.....)))))...)))))......))))).)).....)))).))))(((((.....)))))...........(((.((.....(((..((((((((((.(((....(((.((.((((.((......)))))).))....))).....))))))..)))))))..)))...)).)))..)))).))))))).))))..))))...))))))))))).)).))((((......))))((((..((((((...(((.((.((((.......(((((((((((((........)))).......((.((((((..........)))))).)).((((.((......)).)))).....((((((((.........)))).))))(((.(((((.((((..((((.....)))).....)))).))).)).)))...(((((((((((((((((((....)))))(((((((.(((.(((((((((((((((((.......)))))))))))))...))))..)))))))..)))...(((((((..........)))))))....)))))(((((((((((((((..(((((.((.(((((.((((......)))).))))))))))))....((((((((((.((...(((((.((((...((....)).)))))))))....((((..........))))...((..((((((((..((((.....(((....)))......(((((((...((((((((((...(.....).))))))))))...)))))))))))..))))))))..)).........((((...(((.((((.....)))).....((((.((((.(((....))).))))))))...(((((...))))).))).)))).)).))))))))))(((((.(((.((((((((.(((..(((((((((((((.(((((((.......(((((((((......)))))).))).....))).)))))))))).))))).)).))))).))))))))).))))).(((((((.((((....))))..((((((.......((((((..((....))..)))))).......)))))).))))))).....))))))))............)))))))))))))))).(((((....)))))....))))))))))))))).)))...((((........))))..........))))))............))))))))))))))......))..)))))))...((((((....))).))).............))))))))...)))))....((((............)))).........
Thermodynamic Ensemble Prediction
..(((((((,((((....)))).,.)))).))),((((.{,(((((((((,{,(({{({{..((((......)))).}}}..,))))||(((((..{,{{{{.,.(((((((((((((((((((((..(((((({,,....|||..,...{((({.||,....,.)})))))))...))))))))))).,(((((((((((((((({{{....,{{{{{(...(((((((.((((..((((((((((((..((((((........)))}((((...})))......}}..)))),,)))))))..,.....((((..{{{,..............((((........)))).,(((,,,...|}}|((.(((((.(((((((((({...,)))))...)))))......))))).))}...}))))}}}}}(((((.....})))).,...,{{,.....,|,||...(((..((((((((((.(((....(((.{({((((.((......)))))).)...,,))).....))),))}.}))))))..)))..,)),}....)))).))))))).,,}},}))),...})))))))))),)}.}|((((....,.))))|(({,.{(((({...|||,||,||||....,.||{||{{((,{(((........)))}.}}....((.((((((..........)))))).)|{((((.(,{{{..{||{|,}|.....||,,|}))}}}}.}.)})))){||||{{,.|||||.((((..((((.....))))..,,.)))),))),}).})},|.((((((((((((({(((((,...}}|||(,,(((,.{||,||||(((((((((((((.......))))))))))))),,,)))}..)))))))}..}}...(((((((..........)))))))....}||}|(((((((((((((((..(((((.((.(((((.((((,.....)))).))))))))))))....({((((((((.(({,,(({{(,(({{...{|,...)).|}|}|}}}}....{{{(.{,,,....||||}...{((..((((((,..((({..{{.,,({,{,|{{{,{{(,(((((((...((((((((((...,.....,.))))))))))...))))))),,||{.}}},,},)})..,},.},,.}|}}.}}.,}},}))}}}.}})||..}}}.((((,((((.(((....))).))))))))...(({{{,..}}})},}},}}))},}}.))))))))))(((((.(((.((((((((,((,..,,(((((((((({,(((((((.......(((((((((......)))))).))).....)))}))))))))))))}))).,)})))}}.))))))))).))))).(((((((.((((,,{{|}}|..{{{{{{,,..,,.{{{{{{..{,..,,)},.}}}}}}.,..,})))))),.))))))).....))))))))............)))))))))))))))).(((((....)))))....},}})))}}}|||||.,,,...,|||}}......)))}..........)))}}}............})))))))))))))..,.})))..)))))}}...((((((....))).))).....))).))))))}))))),...,|||.,..((((............))))......,,,

Transcripts

ID Sequence Length GC content
GAGGCCCUGUCUAGGUAGCUGGCACCAGGAGCCGUGGGCAAGGGAAGAG… 1747 nt 0.5518
Summary

Chitinases catalyze the hydrolysis of chitin, which is an abundant glycopolymer found in insect exoskeletons and fungal cell walls. The glycoside hydrolase 18 family of chitinases includes eight human family members. This gene encodes a glycoprotein member of the glycosyl hydrolase 18 family. The protein lacks chitinase activity and is secreted by activated macrophages, chondrocytes, neutrophils and synovial cells. The protein is thought to play a role in the process of inflammation and tissue remodeling. [provided by RefSeq, Sep 2009]

Forensic Context

A study in mice demonstrated that chitinase-like 3 (Chil3) mRNA and protein expression in wounded skin peaks at 2 days post-injury, with Chil3-positive cells, primarily neutrophils, localized to the scab and granulation tissue between 1 and 3 days, establishing it as a potential histological marker for 1–3-day-old wounds [Murase et al. DOI:10.1007/s00414-017-1658-7]. In humans, transcriptomic analysis of subcutaneous adipose tissue from BMI-discordant monozygotic twins identified the CHI3L1 gene as upregulated in heavier co-twins, associating it with apoptotic and carbohydrate metabolic processes in the context of obesity [Muniandy et al. DOI:10.1038/ijo.2017.95].