| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGGCCCUGUCUAGGUAGCUGGCACCAGGAGCCGUGGGCAAGGGAAGAG… | 1747 nt | 0.5518 |
Chitinases catalyze the hydrolysis of chitin, which is an abundant glycopolymer found in insect exoskeletons and fungal cell walls. The glycoside hydrolase 18 family of chitinases includes eight human family members. This gene encodes a glycoprotein member of the glycosyl hydrolase 18 family. The protein lacks chitinase activity and is secreted by activated macrophages, chondrocytes, neutrophils and synovial cells. The protein is thought to play a role in the process of inflammation and tissue remodeling. [provided by RefSeq, Sep 2009]
A study in mice demonstrated that chitinase-like 3 (Chil3) mRNA and protein expression in wounded skin peaks at 2 days post-injury, with Chil3-positive cells, primarily neutrophils, localized to the scab and granulation tissue between 1 and 3 days, establishing it as a potential histological marker for 1–3-day-old wounds [Murase et al. DOI:10.1007/s00414-017-1658-7]. In humans, transcriptomic analysis of subcutaneous adipose tissue from BMI-discordant monozygotic twins identified the CHI3L1 gene as upregulated in heavier co-twins, associating it with apoptotic and carbohydrate metabolic processes in the context of obesity [Muniandy et al. DOI:10.1038/ijo.2017.95].