| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGUUUCCUGAGUUGCUGCUGCUGCGGCGGCGGCAGCGGCGUCUGUGCUU… | 1109 nt | 0.4743 |
This gene encodes a member of the CHIC family of proteins. The encoded protein contains a cysteine-rich hydrophobic (CHIC) motif, and is localized to vesicular structures and the plasma membrane. This gene is associated with some cases of acute myeloid leukemia. [provided by RefSeq, Jul 2008]
A study in rhesus macaques identified the CHIC2 as a differentially expressed gene that was upregulated in animals with hypertrophic cardiomyopathy compared to healthy controls [Rivas et al. DOI:10.1038/s41598-024-82770-4].