Basic Information

Symbol
CHRNA7
RNA class
mRNA
Alias
Cholinergic Receptor Nicotinic Alpha 7 Subunit Cholinergic Receptor, Nicotinic, Alpha Polypeptide 7 Cholinergic Receptor, Nicotinic, Alpha 7 (Neuronal) Nicotinic Acetylcholine Receptor Subunit Alpha-7 Neuronal Acetylcholine Receptor Subunit Alpha-7 Cholinergic Receptor, Nicotinic Alpha 7 NACHRA7 NAChR7 Neuronal Acetylcholine Receptor Protein, Alpha-7 Chain Acetylcholine Receptor, Nicotinic, Alpha 7 (Neuronal) Alpha 7 Neuronal Nicotinic Acetylcholine Receptor Alpha-7 Nicotinic Cholinergic Receptor Subunit A7 Nicotinic Acetylcholine Receptor CHRNA7-2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_000746.6
Sequence length
6149.0 nt
GC content
0.4357

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1868.50 kcal/mol
Thermodynamic ensemble
Free energy: -1993.64 kcal/mol
Frequency: 0.0000
Diversity: 1282.42
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.((((.((((.(((((((((((((..((((.(((.(.(((......)))))))))))..)).))))).)).....))))))))..))))))))))...(((.(((.(((((((((((.((....))))((((((.(((((.(.(((((((((((((((((((...(((((((((.((((..((((.(((....(((((((((...))))....((((((((........(((((((...(((.(((((.....))...))).))).)))))))(((((((((((((........((((((((((....)))))))..)))......((((......))))((((((((((((((.......((.(((((.((((.((((((.((((......))))))))))..)))).))))).)).....((((((....))))))..((((((((((...((((....)))).(((..(((((((((((.((.(((((((.((((((((..(((((((.(((.(..((.((((((....)))).)).))...).))).))))))).((((((((...(.(((..(.(((((((......))).)))).)..))).)...))))).))).)))))))).)))...))))...)).))))..)))))))...)))..((.((.....)).))..((((((((.(((((......((.(((......))).))(((((..((((.(((((..((((.((.(((...))))).))))...((.(((((((..((((((((.....((.((((((((((((((.((.(((((((.((((((.((((((.((((((...(((((((((((((((((....)))....)))))).))).....(((((..((.(((.(((..(.(((((....)).))))))).)))..))..)))))..((((......)))).........(((((.((.((.((.(((((((((.((((((((((.((((......))))...))))))))))....((((...))))(((.((...(((.(((.(((((..(((......))).))))).))).))).)).)))......))))))))).)).)).)).))))).))))).))).)))...)))))).))))))))))...))).)).))))))))))))))))..((.((((((((..(((((..(((((....((((.....)))))))))..).))))..((((((...(((((((.((((((.......))))).((((((((..(((.....)))....))))))))(((.((((((((((.(.(((.(((....)))))).).))))((((((.((.((((((..((.(.(((.(((((((((((((((..((((((((.(((..(.....)..)))))))))))..)))(((.((((....)))))))..)))))))))))).))).)(((....)))......((((((..(((((........((((((....)))))).(((((.(((......))).))))).(((....)))..((((.(((((....))))).))))..(((((.....))))))))))..))))))...)))))))).)).)))))))))))).)))).))))).))...))))))..(((((((((((.......(((((((.(((.(((((.(((..((((((((((......(((((.((((((....((((...))))........((((.(((((((..((((((((((((....(((...(((((((((((((((((...((.((((.....)))).))...))))..))).(((((((((....)).(((((......)))))(((......))).((((((((((((((((...(((.((((.......(((....))).......)))).))).)))))).)))))..))))).............................))))))).....))))))))))..)))..............................((......)).......((((((.(((((.((((((.(((((((......)))))))(((((((((.....)))))))))....)))))).)))))))))))..(((((...)))))..))))))))))))....))))))).)))).))))))..)))))......)))))))))).))).))))).((...(((((.((((((.....((((...)))).((((((((..(((((......))))).(((((((.(((((((....))).)))).)))))))(((((....))))))))))))).........(((((........)))))..)))))).))))).)).........))))))))))..(((((((((....)).)))))))........(((((..........))))))))))))))))..............((((((((((........)))))).))))............(((((.((((((..(.......)..)))))))))))...((((((((((....(((((((((((((..(((((((.((((((((((((((((......))))))))))))))).).))).))))..(((((((((.((((((((((((((((...(((((((.(((......)))))...)))))...))))((((..((((.(((((((((((.(..(((((((((..(((..((((.........))))...)))....)))))))))..)))))).))))))))))......))))..((((..............)))).......)))))))))))).........(((((((.((((((((((((((.((....)))).))))))..))))))...))))))).............))))))..)))....((((......)))).(((((.(((((((((((.(((((((((((((....((...(((((.......)))))...))....)))))))))..((((((((((..........))))))))))((((((..(((.....)))..))).)))........((((........))))..((((((((((.............))).)))))))...................((((((..(((((.(((((....)))).).)))))..((((..(((((((.((.(((((((...(((((((......((((....)))).(((((....)))))...)))))))..))))))))).))))))).))))))))))..))))))).)))).)))).))))).(((((((..(((((..(((((.....)))))..))))))))))))......)))).)))))))))..)))))))))).))))))..)).)).(((....))))))))))).............(((.((((.....)))))))............((((((((((((((((((....(((((((((((((..((((((((((((...((((.....((((((((...)))))))).....))))..................))))))))))))(((((((....))))))).((((((((...)))))))).(((((..((....))..)))))((((((((.((((........((...(((((((((...............)))).))))).))......))))...))))))))(((((((.((((((.((((.......))))..))))))(((((...)))))))))))).......)))))))))))))..)))))))))))))))))).....))))))).))..))))))))))))))..(((((((.((...)).)))))))(((....((((((....)))))).)))))))).)))))))))))))))))).......((((((.(((((((..(((((((...((((..(((....((..(((((((((((((.((.((......)))).))))).)).(((......)))...((((((((((((((((....((((....))))...)))))..(((((........)))))...(((....)))...((((((((....(((((((..((......(((((...((((((.........)))))))))))(((....(((((((..............)).)))))...))).........))..))))))).....))))))))((((......)))).)))))))))))...........(((.........)))))))))..............(((((((..(((((...))))).)))))))((((((....)))))).....))....)))..))))))))).))..)))))))))))))(((((((.......))))))))))))))))))))).........((((((((...)))))))).)))))).))))))).....(((....)))...(((((((....)))))))..............................((((((.....))))))..............(((((((((.......)))))))))......))))))))...))))).....))).))))..))))...))))))))).)))).)))))))..((((((((......((((((................(((((((....)))))))..)))))).......))).))))).....))))))))...).)))))))))))(((((((((........)))))))))......))))))))).((((........(((((....))))).......)))).(((((...(((((((((((..........(((((......))))).(((((((..........)))))))(((((....((((.......(((((..(((((.((........)).)))))....(((((......))))).(((((((..............))).)))).............((((......))))..))))).......))))..)))))((((((......))))))..(((((((((((((....))))....)))))))))..(((((((((.............(..(((..(((((((((....((((.((......(((((((......)))))))..((((((((....))))))))...........((((((((....((......))....))))))))(((((((...((((....))))...)))))))((((...))))..(((((((((((.((((((((..(...((.((...(((...((.((((.(((.((((....(((((.(((.....))).)))))..))))..))).)))).))....))).)))).)..)))))))...).))))..))))))).......(((((((((((.......))).)).))))))...........)).))))....)))))))))..)))..)....))))))))).....)))))))))))(((((...(((((((((((....(((((((....((((....))))....))))))).((((((((((...(((((....(((.((((....(((.(((((((.(((((.(((....((((.(....)))))((((.((((...((((.(((((.(((((....)))))..))))).))))..))))..))))..........))).))))).))))))))))....)))).)))....)))))...))))))))))...........)))))))..))))...)))))(((((.....))))).((((((.((((((((......)))))))).((((..((((((....(((((((((((((((.............))).)))..))).....))))))...)))))).)))))))))).....)))))......................))).)))............
Thermodynamic Ensemble Prediction
((((((.{(((.((({{(((((((((((((..((({{(((.({((,....}})}).)))))))..)).))))).)).....))))))))..)))}))))))...(((.(((.((((((((({{.((....))}}(((({(((((((.(.(((((((((((((((((((...(((((((((.{{{(,.({({.(((,,.,(((((((((...)))),{..((((((((........(((((((...(((.(((,,.....,,.}.))).))).)))))))(((((((((((((.....,,,{{{(((((((....)))))))..)))......((((......))))((((((((((((((......,((.(((((.((((.(((({({((((......))))))))))..)))).))))),)).....((((((....))))))..((((((((((.{{((((....)))},||{..(((((((((((.{{.(((((((.((((((((..(((((((.(((.{..((.((((((....)))).)).))...,.))).))))))).((((((((...,,(,{..,{((,(({({{{{,.,,)}))))}).}))},}.},))))).))).)))))))).)))...))))..,...))))..))))))){{{|||..,,|||..,,))}..,..((((((((.,((((.,....((((((,,,.{{|||..,{((((..{(((.(((((..((((.((.(((...))))).))))...{{.(((((((..(((((((,...,.{(.((((((((((((((.((.(((((((.((((((.((((((.((((((...(((((((((.,.|}}}}}}}}|{{{...,}}}}..,},.....(((((..,{.(((.(((..(.(((((....}}.)))}))).)))..}}..)))))..|{{{...,..}))}.....{{,.(((((.((.((.((.((((((((({((((((((((.((((......))))...))))))))))....((((...))))(((.((.{{({{.(((.(((((..(((......))).))))).))).}))})).)))....}.})))))))).)).}),)).))))).,,})),)))},))...)))))).))))))))))...))).)).)))))))))))))))}.}((.((((((((.,(((((..(((((....((((.....)))))))))..),}))).,((((((...(((((((.{{{((({,....,)))),.((((((((..(((.....)))....))))))))(((.((((((((({,(.{({,(((...|||||}}.)|)))|(({(((.{{,(((({(,.,,.{.(((.(((((((((((((((..(((((((,{(((..,.....}..)))))))))))..)))(((.((({....}))))))..)))))))))))).))).,{{{,,.,)))}.,,,.||||{{,.{{{{{....,,..((((((....}))))).{{{((,(({.....,})),))))},((({,.,|||{.{(((,{{{{|,,,.,)))).}}}},.(((((.....})))))))))},)))))),,,)))))))),)).}}}))))))))).))),.))))),))...))))))..(((((((((((....{{.{((((((.{{(,(((((.(((..((((((((((......(((((.((((((....((({...})),........((((.{((((((..((((((((((((....(((...(((((((((((((((((...((.((((.....)))).))...))))..))).(((((((.({{{{{{,(((((......)))))|||...,,{||,...||||||,,((((....}))},}||||......{{{....}}},,,{..(({{{..}|..|}}}....}}.,}},.,}|}}|...........}}..,.........))))))).....))))))))))..)))............,,,..,{,.......,,,|{......)}.......((((((.(((((.((((({.(((((((......)))))))(((((((((.....)))))))))....}))))},)))),))))))..(((({...)))))..))))))))))))....))))))}.)))).))))))..)))))......)))))))))).))).))))).((,{{{(((({(,,,||}}},.((((...)))).{{((((({..({(((......))))).{((((({.(((((((....))).)))).))))))}(((((....))))),}}))}))})}}}}...(((((........)))))...,)}}},.)))))),...,},,{(((,,,,}}}}..(((((((((....))))))))))........{((((..........))))}))))))))))).....,,..,....((((((((((........))))))},))).....,,.,...(((((.((((((..(.......)..)))))))))))...((((((((((....(((((((((((({..(((((((.{(((((((((((((((......))))))))))))))).}.))),}))),.(((((((((.((((((((((((((((...((((({(.(((......)))}}...))))).,,))))|,{{|,({((.(((((((((({,(..(((((((((.{(((..((((......,..))))...))}..,.)))))))))..)))))).))))))))}|......{{{{...,,|,..,}}}}...,,,}}},.......})))))))))))..,......(((((((.((((((((((((((.((....)))).))))))..})))))...))))))).............))))))..))).,..((({......}))).(((((.(((((((((((((((((((((((((....({,{,(((({...,,,,))}))...}}....)))))))))}.((((((((((..........))))))))))((((((..(((.....)))..))).)))...{{{{{((,{.,,.,,,,}},...((((((((((.............)))}}))))))...,,{{{,,.......,.,{||||,.(((((.(((((....)))).).)))))..,,{{,,,{{||||,({{(((((({...(((((((.,.{((((({....))},..,..,...,)))).,,.))))))),.}))))))),,))))),),.)))))))}}..,))))}),)))).)))).))))).{(((({,{{(((((..(((((.....)))))..)))))))))))}......}))).)))))))))..)))))))))).))))))..)).)),(((....))))))))))).............(((.((((.....)))))))...,....,,..{(((((((((((((((((....(((((((((((((.,((((((((((((,,,({{(.....((((((((...)))))))).,...}}}}.,,,,...}.........)))))))))))){((((((....)))))))|{{(((((({{{.,...,,,...,})))}}}}}|,....{((((((({(((({....})))}.......{((((((((...............)))),,)))))))))))}...,,.....,.|||.(((((((.{(((((.((((.......))))..)))))}(((((...))))))))))))..,..,.)))))))))))))..)))))))))))))))))),,...))))))).}).,)))))))))))))}..{((((((.(,...}).)))))))|||,,..(((({{....}})))),,,.)))),.))))))))))))))))))......,{((((,.(((((((..{,{((((.,{((((..(((,,,.,,....,,(((((((((.((.((......}})).))))).))}|((......})}...((((((((((((((((.,..((((....))))..,)))))...,,,,,,,,,..,||,,..|||{{...,))),..((((((((.,..(((((((..{{......(((({..,((((((.........)))))))))))({{....((((({{..............)).)))))...))),{,...,,.})..))))))).,,,.})))))))((((......)))).))))))))))).......,,,,({{.........))),}}))|,.......,|,...{{({{((,,(((((...))))).)))))||((((({....})))))},...))....)))..})))))))).},..)))))))},))))||{(({{.......})}}}}})))))))))))))).........((((((({...}))))))).)))))).))))))),....(((....)))...{((((((....)))))}}.,,....,{{,,,....,,......,....{{{{{{.....))})))...........,,{(((((((((.......)))))))}}},}},,))))))))..,,.})},....))).)})),,)))),..))))))))).))))},))))))..((((((((......((((((................{((((((....))))))}..)))))).......)))}})))).....))))))))...).)))))))))))(((((((((........)))))))))......))))))))).((((........(((((....))))).......)))).{({{{...(((((((((((.,{{......{{{{|......,}}},{(((((((.......,,.)))))))|{{{{....({,,.,,,...,,,{({{(((({.((,.......)),)))}}.,,,||{{{......})}}}..,,,{({....,,........,,,,||||,,.,,..{{,,,,({{(,,,...}|||,,|||}}..,..,,|}}}..}}}}}{(((((......)))))}..(((((((((((((....))))....))))))))).,({,{{{((,{,.{{{,,{.{{{(..(((..(((((((((,,,,{{{{.||......(((((((......)))))))..((((((({....}))))))).....,,,...((((((((....{{......,}.},.))))))))(((((((...(({{....}}},.,.))))))){{{|.,,})))|.{||{{{{,{{{.,(((((,({{{..,{(............,},,|||},||}}|......{{{||.{||,,,,,))}..)))),.})})..))).}}})},)},,,))}|||||,|..}}}},}},,,|,}}}}..}}|||||{{{....||||||||{{|.......})}.})}}})}}}|||.......,}}.}},}....)))))))))..)))..,.}}})}},,}))))}...)))))))))))(((((...(((((((((((....(((((((.,..((((....))))..,.))))))).((((((((((...{((((..{.(((.((((....{{{.(((((((.(((((.(({....,,{(,({,...,,||((((.((((,{.((((.(((((.(((((....)))))..))))).)))).,))))..))))....}}}},.))).))))).))))))),}}....)))).))).,..)))))...))))))))))...........)))))))..))))...))))){((((.....))))}.((((((.((((((((......)))))))).((((..((((((....(((((((((({(({{....,..,}....|||,}},..)))}....})))))...)))))).)))))))))).....}))))...,{{|.....,,,.......))).)))............

Transcripts

ID Sequence Length GC content
GCCUCUGUGGCCGCAGGCGCAGGCCCGGGCGACAGCCGAGACGUGGAGC… 6149 nt 0.4357
GCCUCUGUGGCCGCAGGCGCAGGCCCGGGCGACAGCCGAGACGUGGAGC… 6236 nt 0.4400
Summary

The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]

Forensic Context

A study in human burn patients identified the CHRNA7 as a gene of interest, noting that its downstream targets are markedly reduced in burn patients [Wu et al. DOI:10.007/s10753-018-0829-0].