Basic Information

Symbol
CHRNB2
RNA class
mRNA
Alias
Cholinergic Receptor Nicotinic Beta 2 Subunit Cholinergic Receptor, Nicotinic, Beta Polypeptide 2 (Neuronal) Acetylcholine Receptor, Nicotinic, Beta 2 (Neuronal) Cholinergic Receptor, Nicotinic, Beta 2 (Neuronal) Neuronal Acetylcholine Receptor Subunit Beta-2 Cholinergic Receptor, Nicotinic Beta 2 Beta2 Human Neuronal Nicotinic Acetylcholine Receptor Neuronal Nicotinic Acetylcholine Receptor Beta 2 NAChRB2 EFNL3
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000748.3
Sequence length
5857.0 nt
GC content
0.5720

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2389.10 kcal/mol
Thermodynamic ensemble
Free energy: -2484.53 kcal/mol
Frequency: 0.0000
Diversity: 1885.11
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((((((((.((((.....((((....((((((.((((((.((((......)))).)))))).).)))))....))))..((((((((.(.....).))))))))..((((((((.((((.((.....)).(((((((.((.((((((......)))))).)))).))))).((((.((((((.(((((((.....(((.(((........))).)))((((((.(((......)))..)).)))).((((((((...))))))))..))))))).....)))))).)))).)))).))))))))(((((((..(((((.....((((((.(((((((((.....((((((((((.((.(((.(..(((((((.((.((((((((...(((.((......))..(((((....))))).((((((((.(.(((((((.(....).))).)))).)))))))))....))).....))))))))((((.(((........)))))))...)).)))))))((((((((....((((((...((((((......(((((.(((............))).))))).))))))..(((((((((...))))))))).....(((((....((((...)))))))))))))))....))).)))))((((.((.(((......))).)).))))....((((........)))).......((((((...((((...(((((.....)))))...))))..((((((.((((..(((((((......)))))))......((.(((((((.(((.((..(((((..((((((((((((.((((...))).).)))))....((.((((((((((((...((((.((((((......)))))).))))...))............((((((((.....)))))))).......)))))))))).))..)))))))..))))).........)))))..))))))).))............((((.(.(((((((((...((((((......))))))))))))))).).)).))....)))).))))))))))))..).))).)).)))))))..))).....))))))))).))))))....((.(((((((.((((((((((((((.............))))))))))((((((((((.(((((...(.(((((((((.....((.((......)).)).....)))))))))).)))))...)))).))))))(((((.(((((((..((.....))(((((.......))))).(((((((((.(((.((.(((.(.((((((((((((((((((...))).))).).))))((((((......)))))).((..((.(((((((((...(((((((((((((((..((..(((.....))).))..))))))))))))))))))).))))).))..))((((((.......))))))...))))))).).))).)).))))))).)))))))))))))))))...))))))).)))).))...((((...((((((.((((((((((((.((((((((...(((.((((.(.((..(...(((((....))))))..)))))))))))))))).)).))))))))))..(((((...)))))..)).))))))..))))(((((.(((((.(((((.((((((((....((((((((((((.......(((((((....((((((.(((((((.((((((...(((...((((.((((.(((.((((((..((((((...))))))..))))))))).)))).))))))).....)))))).(((((...))))).................))))))).)))))).((((((.((((.(((((((.(((((....(((((((((((....(((((.(......).)))))...)))).((((((((.((((...(((..((....))....)))..)))).)))))))).)))))))..)))))...((((((((((.......((((((.((.((((.((..((((((((((..((.((.(((((....))))).)).))(((..(.((((((((((((((((((((.(((.(((((((((.((((....)))).((((((..((((....)))).....(((((((((((....((((((((.((((((((.((((((((......))))((((((((.....))))).)))..((((((((((((((((((.((..(((.(((......)))))).)).))))..((((...(((((.((((...))))..)))))..)))).))).))))))))...)))((((((....))))))...(((....)))..))))..))))))))..................((((.(((((((.((((((..((((((((((((...(((((..(((.(((((((..((((((.((((.(((((((((...(((((((.....((((((.(((..(((((..(((((((((((..................(((((((((......)))))))))((((..((((((....((.(((((((.((((.........(((((((..(((((.(((((..(.(((((((.(.(((.......))).)))))))).)..))))).)).....(((.((.(((.(((...(((((.((.(((..(((........)))..))).)).)))))...))).).)).)).)))......(((...)))..(((((((.((((((....))).))))))).)))(((((((((((...(.((.((....)))).).))))).))))))))).)))))))..))))...))))))))).))))))..))))(((((((((........(..(.(((....))).)..)))))))))).(((((.(((.(((.((((.(((((........(((.(((....)))...))).....))))).)))).))).)))))))).(((((....)))))....(((..(((((((((((......)).)))))))))..))).......))))))))...))).)))))......)))))))))(((..((((...(((((.(((((((......)).))))).)))))...))))...)))....((((.((((.((((((.(.((((.((((.(((((((.(((((...)))))..)))....)))))))))))).)...)))))))).)).))))))))))))))))))))((((((.....)))))).(((.((((.(((((((.((....)))))))))...)))).)))(((((((...(((((.(.((((.......)))).))))))..)))))))...........(((((.((...(((.((.((....)).)).)))..)).))))))))))))))).))))))).))).......((((.(((((((.(((((............)))))...)))))))..)))))))))))))))).......)))))....))))))))))))).))))(((((((((.((((((((...((((((((((........(((((...(((((........((((.((((((((((((((((.(((((((((((.((((...)))).).)))))....))))).(((((((..((((((...((((.....))))...((((((.........))))))((((.(((((.(((((..(((.(((.(((((((((.((......)).))))))...(((((.((((.(((((((...))))))))))).)))))(..(((((((...)))).)))..).))).))))))......)))))....))))).....((.((((.((((((......)))))).))))))..)))).))))))..)))))))......)))))).))).....((((.((((.....))))..))))....))))))).))))........))))).(((((...)))))((((((..(((((....(((((....(((....))).)))))..)))))..))))))..))))))))).))))))...)))))))).)))))))))...)))))))).((((((..(((..((((.((((.((((((.....)))))).))))...((((((((((((((((((((((((.((((((((.((...)).))))).))).)).))))).))))))..........)))))))))))))))...)))..))))))(((((((((((......(((.(((((((((.(...(((((((..................)))).)))..).))))))))).)))...)))))))))))..))).))))))))))))))(((((.((((...(((((((.((........)))))))))...)))).))))))))))))))..))).)))).).)))))))))))).))).)..))).)))))).)))))).)))))).))))))))))))))))............((((((((.....)))))))).(((((((((....)))))).)))))))))).(((.....))).....((((((.......))))))....)))).)).)))).....)))))))..((((((.....))))))((((.(((((..((.(...((((.((.....(((((.......)))))......)).))))......).))..))))).))))))).)))))))))..(((....)))((((...(((.....))).....((((((.....(((.((((....)))).))).......)).))))...)))).)))))))))))))...))))))))))))))).)))).))).((((((((((......))))))))))..))))..)))).....))))))).(((((((((((((((((((.(((((((.....))..))))).........((((((((...(((((..((((.((((((((((...((((.((((((............))))))..))))....)))))))........(((.......)))))).)))).))))).)))))))).(((((((.((((.(((((.((.....))..))))))))))))))))..(((.....)))((((.(((..((((((((.........)))))))).)))...))))............)))))))))).((((....(((((((((((..((...(((((.(((((((((.(((...((..((((...))))..)))))...))))..((((((((((((.....(((((((.(((((((((((.(((((((..............................(((.(((((.((.(((((((.(((((..((((((((...)))))))).)).)))((...(((((((................))).))))...))........)))))))))))))))))......((((...((((((((((...((.........)).)))))))))))))).......((((..(((..((((.....))))..))).))))...))))))).))))..........)))))))..))......)))))))))))))))))........)))))))))).))..))))))...)))))))))((((...((...))...))))....)))))))))....
Thermodynamic Ensemble Prediction
....,((((((((((.((((.....{(((....(((((,.((((((.((((......)))).)))))).}.)))))....})}},.,{{{((({,{,,,..|{||||||}}.,((((((((.((((.{(...,.||.(((((((.((.((((((......)))))).)))).))))}.((((.((((((.(((((((.....(((.({({((((..((,((({......,.)))).})..)).))))}.))).((((((((...))))))))..))))))).....)))))).)))).)))).)))))))){{....},))))|||{.((((((((((((((,.((....(((((((((((({(((({,,..(((((((.{{.,{((((((.,..{,.((,.....}}..(((((....})))).((((((((.{.(((((((.(....).))).)))).}))))))))..,}},},..}}))))))}|((((,(((,.......}}))))),},},.))))))){(((((((....((((((...{((((({{.({{,..(({..,.....,.,},...))))))),.}})))}..(((((((((...))))))))).....(((({....((((...)))))))))))))))....))).))))}.|{{,((({((,..,,.||{((((((........)})))}{{.|||},||{...))).,))}.)),.{,..(((((.....))))).,}},|},|||{{{{.,,|||.(((((((......)))))))......|,.|((((,{{(,....}}||)))).{,{{.(((((((.((({...})).).))))))).,{..{{|||(((((((...((((.((((((......)))))).))))...,)),....,.,,..((((((((,...,)))))))).,,}},,}}}})})))).)))))))))))}..,)),...)))))),}).)))))).))},||.,,,,,..{{,,{{{,.,.{((((((((...((((((......))))))))))))))),|.}|,((.{,.||||.|||{{|{({(((,,(({{,{|,,,||{{|{,{||...,}}}||||||,,{|||{,|,...((.(((((((.((((((((((((((..,{{.....}},))))))))))((((((((((.,(,(.{{{,.(((((((((.....((.((......)).)).....))))))))),.))),),..)))).))))))(((((((((((((..((.....))(((((.......))))).(((((((((.(((.((.(((.(.((((((((((((((((((...))).))).}.))))((((((......)))))).((..((.(((((((((...((((((((((((((({{((..{{,.....)))})}..)))))))))))))))))))},)))).))..))((((((......,))))))..,))))))).).))).)).))))))).))))))))))))))))),..))))))).)))).)}..{(((,....,,|||}|||||||{|,||.||||{|||}}},||}{||{}||||,.|},}|||||...|)))}},.,})|||||{||||||||,,}.,||||,,||,..(((((...)))))}}.,}))),},,,|||,(((((.(((((.(((((.((((((((....((((((((((((.......(((((((,{..(((((,.{{{{||(,((((({,,.{(({..((((.((((.(((.((((((.,((((((...}))))}..})))))))).)))}.)}))}}|{,.,,|||},|.(((((...)))))......,,,,|||..,,}||}}}},}}}})}{((((((|{{{{,,{((((({{{{{{....{{({{(((({...,}}}))|))}..{{{{.{{{|||{{|,||{(({({{{(.{{{{..,,{,,,||,.,,)),,.,))),,)))),)))}}}}}.})))))}..))))}.,.,,{.((((((...)))))}{{{{,,|.||{|}|..||{{{{||{{{.{((,{(|(((((,...|}|||,||,||{((..(,({{{((((((((((((((((.(((.{((((((((((((((((,(({{.{.{{{{{{({({{{{((((,.,,,{.,,{.{((,{{(((((({(((({(((({(((((,,((((((......)))))}|||((((({.,.,.,,.}))}}||,(((((((((((((((.((..(((.(((......)))))).)).))))..((((...(((((.((((...))))..)))))..)))).))},))))))))...,},((((({....}))))).(((((((...{(|..,{((...(({({.......)))))..))))||,,|}|||||,.||,||||},||||||||}}||}|}|}}}|..|||}|||||||}.||{|||.||{,,{||{|||||||||,((((({{..{{({{(({{,{,,({{{({{{((((((((.{,...,,}))....||{||{((((((({......)))))))))((((..((((((....{(,(((((((.((({.........(((((((..(((((.(((((..,.(((((((.(.(((.......))).)))))))).,..))))).)}.,,,,(((.((.(((.(((...(((((,({.(((..{((........))}..))).)).}))))...))).).)).)).)))..,...(((...}))..(((((({,((((((....))).))))))).)))(((((((((((.....((.((....)))).).))))).))))))})).)))))))..))))...))))))))),))))))..))))(((((((({.,....{||.,|,|||.,..}}}.,...))))))))).{{((({(({{{((.((({.{,,,{{{{,{.,|{{{|{({|,,((||((((({((,,{{|{||,(((|,|((.||.,|||..{{{{||}||)))|||,,,(((..(((((((({{{....,,|}.}}}}}}}}}..})).,}},,||||{,||,,|||,|,,,,||,,,,..|||||,,|{((,..||}))),}{((({(({.,,.})))))))|||||{{|||.}...},}}.|||||,|,,,(((|({|,||(({{{.,|{{{{,{{(({{,,..||}|{|||,,,}}}}|..|||,..{||{{{|{(((|.((((((.........)))))).}))))..}|||{{,.((((((.....))))))|({,,,||{{{({{,{|}||}}}}))))}))},...,((((((((.{,,,....,|}.}))}}}}}.{{{{,{||||{,,{(({{{||||.,...,,|}},}|||{((({,,{{{(({{((..,.,,.,|{||{|||||||,{{{{.|||,}}},,|.||{||||{,|,.....{(((((((((((((,((((({.{{...}}.)}),,,,}}})))))))..))))))))))))))),.,,..,,})|}|,.{{||||||||,,,,|{|||||{{||||||,|,,,||,{,,|||,,,}|},}},,|||.,{{|....})))}))},.,},})))).,}|||,}|||||||||}|||||((((((.((((...)))).).)))))}}}})))))}|||||||}}||||||.,,((((,,,..||||{,{(,(((({,{.,,..{|}}}}}((((.(((...,.,,))})}))))}))).,)))}})))),,,))))}))}},,...,((((,((((.(((((((...})))))))))).))))}{..(((((((...)))).)))..)})})})}))))}...||||||}..{{({(({({....},,||{,{.||||.}}}},)}},|,..})),,..}}}}.,}))}}..)))))))}}}}},).,)))})))}.}}}||{{,|{||},.,{||||..|||{.{{{||(((((({((....})).}))))|(((((({.,|,}}})}}}||{{{{(((,,{{{{,..((((({{{(({((({((((((((...{{.((.((((....)))))),)}..))))))))}{{{{,({((|,,,,}))),))))},.{(((((..((({{((((.((((.((((((.....)))))).)))),..((((((((((((((((((((((((.((((((((.({...}).))))).))).)).))))).))))))..........)))))))))))))))...}))..)))))}(((((((((((....({(,(.(((((((((.{.{,,((((((,.,.....,,.,......)}}).)))}.}.))))))))).})))..))))))))))),,...,.,,.|}}}}}}})))})|}.||}|}}.,,,))}))))}}))}},,)))}}))))...}}}}},)})))))))))}).,))).)))).}.})))}}}}||}}.}||.|{{||{{|||||,.,|||,|......).))))))))),))))))}}}},,......((((((((.....)))))))).{{{((((((....)))))).))))))))))))))))}..,}))})))}..}}})))))..)))},})))))))).,}},,)}...,.)))))}}.,((((((.....))))))((((.(((((..((.(...((((.((.....(((((.......))))).....,)}.))))......}.))..))))).))))}))}}})))))))..({{..,,}})((((.,.,,,...{{{{{{....,|||}}}.,,.{{{.{{|{....})}}.}}}.......,}.}}}}..})))}.)))))))))))))...)))))))))).))))}))))))))}|(((((((((......))))))))))..))))..)))).....))))))}.(((((((((((((((((((.,{(((({{{,,,{...|||||{|||||||||(((((((...(((((..((((.((((((((((...((((.((((((............)))))},}}})),,,.)))))))........||........}}}))).)))).))))).)))))))},{{{{|||,||||,||||{.{|..,..},..))))})))})}}}||,..||{.,.,,||}{||{,|{{,.((((((((.........)))))))).}}}...))))}}},,,..,...)))))))))),((((...,{|{|(((((((..((.,.(((((.{((((((((.({(...((..((({...})))..)))))...))))..((((((((((((...,,(((({{{.((((((,((((.(((((((,,,..{|......,..|,............(((.(((((.((.(((((((.{{(((..((((((((...)))))))).)),)}}((...,,,,{({....,...........}}}.||||....},}}.,,,.)))))))))))))))))....,.((((...((((((((((...((.........)).)))))))))))))),......((((..(((..((((.....))))..))).))))...))))))).)))),,,.....)))))))))}}),....,.}))))))))))))))))........))))}})))).)}..))))))}..})}))))))((((...({...})...))))....}))))))))....

Transcripts

ID Sequence Length GC content
AGACUCCUCCCCCUCACCGUCCCAAUUGUAUUCCCUGGAAGAGCAGCCG… 5857 nt 0.5720
Summary

Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that chronic cocaine exposure and withdrawal induced sustained increases in the expression of the nicotinic acetylcholine receptor subunit gene Chrnb2 in the nucleus accumbens, as validated by quantitative PCR [Eipper-Mains et al. DOI:10.1111/J.1601-183X.2012.00873.X]. In humans, the CHRNB2 was identified as an element within a robust, validated gene coexpression network associated with cocaine use disorder in dorsolateral prefrontal cortex neurons, implicating it in nicotinic acetylcholine signaling pathways relevant to addiction [Huggett & Stallings DOI:10.1523/Jneurosci.2879-19.2020].