| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGAAGCGGCACACUCGGCGAGAGGGGUUGAGAUUGUUUUAUUCCACUC… | 2347 nt | 0.4542 | |
| GAGAAGCGGCACACUCGGCGAGAGGGGUUGAGAUUGUUUUAUUCCACUC… | 2480 nt | 0.4593 |
The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are (hetero)pentamers composed of homologous subunits. The subunits that make up the muscle and neuronal forms of nAChRs are encoded by separate genes and have different primary structure. There are several subtypes of neuronal nAChRs that vary based on which homologous subunits are arranged around the central channel. They are classified as alpha-subunits if, like muscle alpha-1 (MIM 100690), they have a pair of adjacent cysteines as part of the presumed acetylcholine binding site. Subunits lacking these cysteine residues are classified as beta-subunits (Groot Kormelink and Luyten, 1997 [PubMed 9009220]). Elliott et al. (1996) [PubMed 8906617] stated that the proposed structure for each subunit is a conserved N-terminal extracellular domain followed by 3 conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region.[supplied by OMIM, Apr 2010]
No relevant information is available at the moment.