Basic Information

Symbol
CHRNG
RNA class
mRNA
Alias
Cholinergic Receptor Nicotinic Gamma Subunit ACHRG Acetylcholine Receptor, Nicotinic, Gamma (Muscle) Cholinergic Receptor, Nicotinic, Gamma (Muscle) Cholinergic Receptor, Nicotinic Gamma Acetylcholine Receptor Subunit Gamma Cholinergic Receptor, Nicotinic, Gamma Polypeptide Acetylcholine Receptor, Muscle, Gamma Subunit Cholinergic Receptor, Nicotinic, Gamma
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_005199.5
Sequence length
4009.0 nt
GC content
0.5365

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1599.90 kcal/mol
Thermodynamic ensemble
Free energy: -1669.20 kcal/mol
Frequency: 0.0000
Diversity: 780.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((((((.(((((.((((((((((((....((((..(.((....)).)..))))))))))((..((((((((((((((((((......((((((.(..(((....)))..).))))))...)))))))))))..((((((......))).)))..................)))))))..))...(((((...((((((((.((((.((((.(((((....(((((((........(((((((((((((((..((((....))))(((((..((.(((....))).))...)))))((((...))))....((((((((((..(((((...(((((((..((((.((((.((((((.(((((((((((((((((((((((((((...((((.((.(((.((.(.(((.(((....((((....))))....))).))).).)))))...))..)))).))))))...)))))))))((((((((((((((((.((.(((((.((((((..............((..((((((.(((............))).))))))..))..............)))))).))...))))).))).).))))))))).)))))))).).))))))....((((((((.((((((......((((..((((((((((((.((((((((((.((.((((.((.((((((.(.((((..(((....))).(((..((((((..(((.(((((((....))))))(((..((((((((..(((..........(((((((.((((.((..((((.(((((.(((((((((..(..(((((.................(((((..((((((((((..((((((....((((((((((.........((((((((................))).))))).(((((((((((........)))))(((((.............)))))..))))))....))))))))))((((((((.....(((...((((.(((.(.(((((....(.((((((((.((((......................)))).)))))))).)....))).)).)..))).)))))))))))))))))).))))))).))))))..)))))((((((.((((.....))))..)).)))).)))))..)..)))).))).)).))).)).))))..))))))(((((.((((((((.(((.(.(((......)))).)).).))))..))))))))))))))))))).))))))))..))).......(((((.(((..((((((((...)))))))).(((((((((...))))))))).......))).))))).).)))..))))))..)))...(((..((((...))))..)))..((((...))))..))))..).))))))...)).)))).)).)).))))))))..).))))))))))).((((.(((.....((((((...((((((..((((((((((......(((....))).....))))))))))..))))))....))))))..((((((.((..((((((((.(((((..((((........((((.((((((..(((((((......((((((......((((......)))))))))).)))))))....)))))))))).)))))))))..(((....((((((.((((.........)))).))))))....)))(((((....(((((((..(((((.((.((((((..((((((((((((((((((((((((((((((.....))).....)))))))..)))))).)))...))).))).)).)))..))))))..)).))))).....)))))))...................(((((((.(((.(((((((..((((......))))))))))).))).))))))).))))).........(((.....))).)))))))).....)).)))))).((((.((((.....))))))))........((((....)))).....))))))).))))......).)))))..)))).))))..)))))).........))))))))..)))))))....(((((.(((......))))).)))..(((((((..........)))))))........(((((.((((((((((((((((((.........(((.(((.((((((((..(((((((((((.(.((.(((..((((((.((.(((((((((.(((.(((((((((((((((((((((((((..((((((.((((((((((.((.((((((((((((((((((.(((((((((.((.(((((((((((.((((((.((((((((.((((..((((((.((((((.((.(((.((.(((((((((((((((((((((((..((((((((((((((((.(((.(((((((..(((((((((((.((((....(((((((((((((((((..(((((.....)))))...((((.(((((..((......))(((((((..(((((((...((((.(((((.......)))))..))))..)))...((((......))))(((((((((...))))))...)))))))...)))))))((((.(((((.........)))))....((((((.....))))))(((((((((......((.......))(((((((.((.(((.....((...((((.(((((..(((.((((..(((((((((.......)))))).)))....)))))))..))))).))))...))..........))).)).))))))).)))))))))...))))))))).))))....(((((((.((....)))))))))......((((((((.(((((((..(((.......))).))))))).))))))))(((((.......)))))...................)))))))))))))))))....)))).)))))))...........)))).))))))).))).))))))))))))))))..........)))))..)))))))))))))))))).)).)))))..))))))..))))))..))))..)))))))).)))))).))))))))))).)).))))))))).)))))))))))))))))).)).)))))))))).))))))..))))))))))))))))))))))))).))).))))))))).)))))))).))).)).).))))))))))).)))))))).))).))))))))))))))))))))).)))))(((((((((....((((....)))).)))).)))))(((((((.....((........))))))))).((((......)))))))))..)))))......)))))..))))))........(((((((.(((.(((((...(((.((.((((...)))).))..)))...))))).)))..))).(((....)))..))))))))))))))))))))....)))))...((..((((...(((......((((((((......)).))))))))).))))..)).(((((((((..((..(.((((.(((..((.((((((.....))))))))..))))))).)..))..))))))))).((((......)))).......)))).)))))))))..)))...))))).))))))....)))))...))))))(((((.((.((((....))))..(((((.(((.((((........)))).......((((.((((..(((....))).)))).))))....(((((......(((..(((((((......))))))).)))....)))))...))).))))).............)).)))))....................((........))..........)))).
Thermodynamic Ensemble Prediction
....((((((((((.(((((,((((((((((((,...{(((..,.((....)).,..))))))))))((..((((((({((((((((((,,,.,.((((((.{,.{{{.|,.))}},}}))))))...)))))))))),..{(({{{......,)}.))}..................)))))))..))...(((((...((((((((.((((.((((.(((((.,..(((((((........(((((((((....,.,.((((....))))........{((((((((.(((..(((({{{{({{,.,,))))))))((((((.((((.(((.{..,...(((..((.(((((((((((({{,((((((,{(((({({{((((((({{{{||,||||,.{.||,.{|,|,|||,|||,,,.{{((,,,,||}|,.,.}||.}}}.}.|}||},,||,.|}|||.|}||||.,|}))}))))}((((((((((((,{((.(,{(((((.((((((..............((..((((((.(((............))).))))))..))..............)))))).))...))))).))).,.)))))))))},))})))}.,.))))))...,...,}))}).|||{{,{|,|,,,,..)).}))}.))))),))))))))).))..)))..,..}))).))))))))))(((....)))((((.((.(.((((((....)))))).).)).))))))))))))).))}.....((((((((.((..,,..,...........{{|({,((((.......((((((((({(,....((.(((((,..((((((..((((((((((((.,{,({(,{((........)))))),.)))))))..{,,.{{{.{{,(,,{{,.|.}}..}))}})),(((((........)))))(({((,,{{..,,{|...}}}}),,}{((((((,...((((((((((((((....(((({.....(((((((((.{((((....{.((((((((.((((.....,.,......})....,.)))).)))))))).}....)))|||.,.{||,.(((((((((.((..{(.{(,..,,..}|,}}})}))))))))).))}|||{....,)}}}))))))))),))))).....))))))))).)))))....)))))))|))}|||||.,{||{{{{,..)))).|,.........)))))..)))))).)).))))).,)))))))))))((((((((..{{{.(((((((((.(((.(...(((..(((((((({(((.(((((((((...))))))))).))).....(((((.{....,,,.))))),.(((((.,(((..((((...))))..))),.((({...}))).(((((((((((.((((.(((((((((((..(((((({((,({((({{,{{{,{{,||||}.{((((,({{(,,,..({((((((..((((((((((......,({....},......))))))))))..))))}|(((({((.(((((((((.(((((.(((((.(({,((..{(.,.........,,)))))))))).))))).}.......})))))))...((((......)))),|||,,.{{({{,..|||}......}}).}))}..})))},},}}..{(((((.((((.,,...,,.)))).))))))....,)))}})},,}}}...}))),))))}.}},||||||,,|||||||||{{|||||||(((({{(((((,...,,))).,,,,|||||}},,|||}||,}},...))).,,}}))}})),,))))}}...))))))..)))))},)))..}).)))).))))))))))){(((((.(((.(((((((..((((......)))}))))))).))).)))))|(((.(((((((.({.(......,)).))))))).))),....))))),{(.((((.((((.....)))))))).},.....((((....)))).....))))))).)).,))})))).))))}.(((((.(.....).)))))..))))...|||,.,,((((({{{{,,..,{,.{{{{{......,))))))),..{((((((,.......,.))))))}.,,,.....,,...{(((((((((((((((({........,(((.(((.((((((((..(((((((((((.(.((.(((..((((((.((.(((((((((.(((.(((((((((((((((((((((((((..((((((.((((((((((.((.((((((((((((((((((.(((((((((.((.(((((((((((.((((((.((((((((.{(((..{(((((.((((((.((.(((.((.(((((((((((((((((((((((..((((((((((((((({.(((.(((((((..(((((((((((.((((....((((((({(((((((((.{(((((.....,,,|{(({,((.,,,,.{,.,|||,.,,}.{(((({...,.{{(({...((((.(((((.......)))))..))))..)))|(.((((......)))).)|{{,.....((((.(,,(({,((.....))))))).))))..,,,|}},......,))))},..((((((.....)))))).{((((((,...|..,,,...,..,..}))}))}|}.,,,}}))))|((.(((((,{,....((((((......))))))...{(,,((((.((((((((.((..{(((({,.(((((((((.........}...}}.))))))).....))))),,)),))))))}}).)))),.)},,.((((((({,{....))})))))).,,...((((((((.(((((((..((,......}))),))})))).))))))))(((((.......)))))..........))))).)),)))))))))})))))))....)))).)))))))...,,......)))).))))))).))).})))))))))))))))..........)))))..)))))))))))))))))).)).)))))..)))))).,))))}}..})))..)))))))).)))))).))))))))))).)).))))))))).)))))))))))))))))).)).)))))))))).))))))..))))))))))))))))))))))))).))).))))))))).)))))))).))).)).).))))))))))).)))))))).))).))))))))))))))))))))).))))).|||||.,...}}||||...,|}||{|,{|((((,.((((((,.....,........)))))),|||{{{.((((.....)))),}}}))},,.,,}...))))}),)}})}}......,.))))))))(((.(((((.{((((.((.((((...)))).))..))},)}))))).)))))))}}}})}}.}}))))))))))))))))))))))))..,.)))))...((.{((((...(((......((((((((......))}})))))))).))))}.)).(((((((((..((..(.((((.(((..((.((((((.....))))))))..))))))).)..))..))))))))).{{{{......|}}}.......)))).))))))))),.,))...))))).))))),..,.)))))...))))))(((((.((.((((....))))..(((((.(((.((((........)))).......((((.((((..({,....})).)))).))))....{((((......{{{..(((((((......))))))).}}}....})))}...))).))))).............,}.}))))................,,,,((........)){{,...,,,.)))).

Transcripts

ID Sequence Length GC content
GCCCCAGACCUUGGAGCUGUUGUCCCACCCCUGUCACUGCAGAGAGCUG… 4009 nt 0.5365
Summary

The mammalian muscle-type acetylcholine receptor is a transmembrane pentameric glycoprotein with two alpha subunits, one beta, one delta, and one epsilon (in adult skeletal muscle) or gamma (in fetal and denervated muscle) subunit. This gene, which encodes the gamma subunit, is expressed prior to the thirty-third week of gestation in humans. The gamma subunit of the acetylcholine receptor plays a role in neuromuscular organogenesis and ligand binding and disruption of gamma subunit expression prevents the correct localization of the receptor in cell membranes. Mutations in this gene cause Escobar syndrome and a lethal form of multiple pterygium syndrome. Muscle-type acetylcholine receptor is the major antigen in the autoimmune disease myasthenia gravis.[provided by RefSeq, Sep 2009]

Forensic Context

No relevant information is available at the moment.