| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCCCGCUAGGGGAUCCGCGCCAUGGAGGCCGCCCGGGACUAUGCAGG… | 1008 nt | 0.5843 | |
| AGGCCCGCUAGGGGAUCCGCGCCAUGGAGGCCGCCCGGGACUAUGCAGG… | 1543 nt | 0.6241 |
This gene encodes the homolog of the mouse protein Cidea that has been shown to activate apoptosis. This activation of apoptosis is inhibited by the DNA fragmentation factor DFF45 but not by caspase inhibitors. Mice that lack functional Cidea have higher metabolic rates, higher lipolysis in brown adipose tissue and higher core body temperatures when subjected to cold. These mice are also resistant to diet-induced obesity and diabetes. This suggests that in mice this gene product plays a role in thermogenesis and lipolysis. Alternatively spliced transcripts have been identified. [provided by RefSeq, Aug 2010]
A study in humans demonstrated that in monozygotic twin pairs discordant for body mass index, the CIDEA gene was downregulated in the adipose tissue of heavier co-twins, where it is involved in lipid metabolism [van der Kolk et al. DOI:10.1016/j.xcrm.2021.100226]. A study in pigs demonstrated that the CIDEA is a gene previously reported to play important roles in fat tissue after cold exposure and is regulated by transcription factors including SIX1, SP2, STAT4, and HIC1 [Guo et al. DOI:10.1016/j.jgg.2024.06.017].