Basic Information

Symbol
ADAMTS4
RNA class
mRNA
Alias
ADAM Metallopeptidase With Thrombospondin Type 1 Motif 4 ADMP-1 KIAA0688 ADAMTS-2 A Disintegrin-Like And Metalloprotease (Reprolysin Type) With Thrombospondin Type 1 Motif, 4 A Disintegrin And Metalloproteinase With Thrombospondin Motifs 4 Aggrecanase-1 EC 3.4.24.82 ADAM-TS 4 ADAMTS-4 ADAM-TS4 Epididymis Secretory Sperm Binding Protein EC 3.4.24
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Wound age identification

MANE select

Transcript ID
NM_005099.6
Sequence length
9777.0 nt
GC content
0.5143

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-4041.90 kcal/mol
Thermodynamic ensemble
Free energy: -4202.74 kcal/mol
Frequency: 0.0000
Diversity: 2538.50
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((.....(((...))).(((((.(((((.(..((((((((.(((((((((((((((((((((..((((..(((.(((.((((((((((.(((((((.(((((.(.(((((((.(((...)))...(((.((((((((((((...((..(((((((((((.(((.(((((((.(((((.........(((((((((.(((((((((...(((((((((.....((.(((((...........))))).)).....).)))))))))))))........)))).))))))))).....)))))(((((.((((((((.(((((((.((((....)))).......)))...))))...))))))))..)))))....((((((((.....(((..((((((((((.((((......))))(((.((((...))))))).........)))))))))).)))))))))))(((.(((((((((...............)))))))))...))).))))))).))).)))).....)))))))..)).))))))))))))))).........(((((((((...(((((((....))))).)).....(((((((((.(((.((((..(((((((.((.(((((((((((((.....((((...((((((((.(((((((((.(((.....((((.(.(((((.(((....))))))))).))))))).)))))))...)).)).))))))))))..)))))))))))))...)))))))))((((((((((((((((((.....((.....))..(((....))).....(((.(((((.(((.....((((((((((((((....))).((((((.(((((.(....((.((((((((...........)))))))).))..).))))).)))))).((((((((((((((..(((...........)))...)).))))).))))))).....)))))).))))).......((((((....)).))))...))))).))).)))....))).)).)))))))))))))))))...))).)))))))))(((((((((((((((.(((((((((((((((....)))))))((((...(((((..((((((.......)))))).))).))...))))........(((..(((((.((.((((((((.((..(((((.(((((.(((((.(.(((((((((((((((((...(((((((....)))))))...((((((.((.....((((((...))))))))))))))((((........))))......))))...)))))))........((((.....)))).......)))))))))).)).))))).))))).))))))....))))...)).))))))))..))))))(((((((((.(((((((.(((.....(((((((.((((((...))).))).)))))))))).)))).))).)))))))))((((...(((((..((((.(((.......(((((((((..((..((..((((......)).))..)))).))).))))))...))).))))..))))))))).....(((((((((((....((((((((((((.....(((.((.((....)).)).)))...)))))))))).....))....))))).))))))..))))))))))..........(((....)))............)))))))).))))))))......)))))..((.(((((((((..((....(.((((((((((((.....((.((((((((..((((((......))))))......))))))))(((..((((.((((...(((...))).(((((((((((((......)))))))).)))))((((((((((((.((........(((((((((((((.....((((......)))).)))))))).))))).(((.((((((.(((((...(((.(((((((((((((((............(((.(...((((((((.((((....((((..((((....((.(((.(.(((..((((...(((((...(((..((((...((((((.((((.....((((((...(((((..((((..(((((((..((.(((((((.((((((..(.((((.(((((((..(((((..((.(((..((.((...(((((((...((((.((..((((((...((((.((.((((((........)))..(((((((...)))))))...)))..)).)))).))))))..))))))..)))))))))))..))).))..))))).(((((((.......))))))).((((((((((.(((((((((...)))).))))).((((......))))......)))))).))))))))))).)))).))))))).))...))))))).)))))))..))))..)))))...(((((....(((((((......((((....))))....)))))))..)))))((((((((((...))))(((((..(((...)))...))))).....)))))).((.(((......))).))....(((....)))(((((((((((...((((....))))........)))))).)))))...(((....)))))))))..))))))))))......((((((((..((((((...)))))))))..))))).)))))))...))))).))))..))))))).))...))))))))..))))...)))))))).))))............))))))).))))))...((((((((((((.........))).))).)))))))).)))...))))))))))))))..(((((((((((..........((((((.(((((.....)))))))))))....((.((((((((((((.((.(((.....))).)).)).)).)).)))))).))(((.((((((((((...((((....).))))))))))))).))).........(((((.....)))))....))))))))))))))))))))))))))))).))))..)))..((((((..(((...(((((((.......(((((((((((.((((.(........).))))))))))..)))))))))))))))))))))(((.(((..(((...)))..)))..)))......((((.((((((..((((.....((...(((((..((((.......)))).))))).))....))))..)))))).)))))).....)))))))))))))...))....))))))))).))..)).).))))).))).............(((((((.......))))))).)))))))))))))).)))..)))..))))..))))))((((((((((((........(((((((.((((((.....)))))).)))))))))))))))))))))))))))))))))).))))))))(((((.((.((((((((((((.((((((((((((((((.((((.((((((((((((((((.(..(((.(((((((((((.(((((...........(((((....)))))((((((((......(((....)))......))))))))...................(((.((((((((...))).))))).)))(((((((((...))))))))).(((.(((((.........))))).)))..(((((((((((((((.((((((((((((((.((((((((((((((..(((((.(((((((((((.(((((((((((((((((.((((((((((((..((.((((((((.(((((((((.(((((((((((..(((((((.((((..(((.((((((((((((((((((((((((((((((((((((((((((((((..((((.(((((...........)))))...((((((......)).))))((((((((.(...((((...((((....))))...)))).).)))).))))(((((......))))).(((.((((((......))))))..))).........(((((((((((..........(.((((((....))).))).)(((((.((.(.((.(((((.(((((.(((((((((((((.....(((.((((((......((((.((((.(.............).))))))))......))))))..)))(((((...............))))).)))))))....((((((....))))))..((((((((...((((......(((.((((.(((....(((.(((((((((((((((.....(((......))))))).)))))))......(..(((.(((((.((((((.((((.(((......))).)))).(((((...(((((..(((...........)))...)))))...))))))))))).))))))))..).((.((((((((((........)))..................(((((((...........................)))))))...........))))))).)).....)))))))...))))))).)))))))...))))))))..)))).)))))))))))))).).)).))))))))))))))))))))..)))(((((((...((((((..((((((((....(((((..(((((((........)))))..(((((.((........)).)))))..(((.((((((((.(.....).))))))))..)))...........((((((((...(((((........)))))...))))))))..(((.((((........)))).))).....)))))))...))))))))....)))))).....)))))))..(((......)))................)))))))))))))))))))))))))))))))))))))))))))..))).)))).)))))))))))))))))).))))))))).....)))))))).))..)))))))))))).)))))))))))))))))((((((((((....))))))))))))))))))))).)))))..)))))))))))))).)))))))))))))).))))))))))))))).))))).))))))))))).)))..).)))))))))))))))).)))).)))))))))))))))).)))))))))))).)))))))........................).))))))))))(((((.(((((((......))..............((..(((((.(((((((.(.((((.(((((((((((....((((..........)))))))))((((((.((((((...........)))))))))))).(((.((((((((..((((((((.....)))))))).........((((((((((((((((((((((((((((((((((.((((((((((((.((.((((.(((((((((.((((((((((((.(((.((((((.((((((...........((((((((((((((((((.(((((((((((((((((((((((.((((((((((((((((......((((((.((((((((((((.((.(((((((((.(((((((.((..((..(((((((.(((((((((((((((.(.(((.(..............................((((.(((((((((((((((((((.((((((..((.(((((((((((((((((((.((((((((((.(((((((.((.(((.(((((((.(((.(.((((.(((((((((((((......((((((((..(((((((((((..(.((((.((((((.((.((((((.((((.(((((..(((((...((((((.((((((((.(.((((((((((((((((((.((((((((((((.(((((.((((((.((((((((.(((((((.(((((((((((((((.............((((((((((((((...(((((((..((((((((((.....(.(((..((..((((((..((((((((..(((........))).....))))..((((((..(((((((...((((((..(((((((.(.((((.((((((((...((((.(((......((((((..(((((..((((.(((((((((..(((.....)))......))))))))).))))..)))))(((((((.(.((.((((.......)))).)).)..))))))).....)))))).......)))))))..(((((((.((......(((((.((((..((((....((((((........)))))).((((.(((..((((........)))))))))))......))))..)))).)))))......)).)))))))............)).))))))..)))).)..))))))).......))))))......(((...))))))))))...))))))))))..))))))..))..))).)........(((..((((((....)).))))..)))))))))))))((((........))))((((((.....(((((((..((((((((.......))))).)))...)))))))....))))))....(((..((((...))))..))).....))))))).)))))))).....)))))).((.(((.(((((.((.((((((((.(...............).)))))))).))...)))))))).))...((((...((((..((..((........))..))..))))..)))).((((((..((((((....(((((((((.(.(((..(((..((((.....)))))))))).).))))))))).......))))))..))))))..........))))))))))))))).))))))).)))))))).)))))).))))).)))))))))))).)))))))))))))))))).).)))))))).))))))...)))))..))))).)))).)))))).)).)))))).)))).)..)))))))))))..))))))))..))))))))))))).)))).).))).))))))).))).)).))))))).))))..............((((...)))))))))).))))))))))))))))))).))..)))))).))))))))))))))))))).))))((((...))))).))).).))))))))))))))).)))))))..))..)).))))))).))))))))).)).)))))))))))).))))))......)))))))))))))))).)))))))))))).(((.((((((.............((.(((((((((....((((..(((((..(((.....))))))))))))..((((.....(((((((.(((.......)))..)))))))...))))..(((((...((((((((...(((((.((((......(((((((.....(((.(((.((((((((........)))))))).....))).))).....(((((...))))).)))))))......)))).))))))))))).))(((((....(((((...((((((((((.......((..(((((.((....((((((((.(((((.((...((((......))))..))))))))))))))).....)).)))))..)).......)))))))))).((((....)))).....))))).((((....)))).))))).)))))......))))))))).))...(((((.((((((....))).))).(((((.(((((....((((((((((...(((((((((((.((((((((((..(.((((((.((....))))))))...)..))))))....(.((((((((..(((((((((..(((((....))))).)))))).))))))))))).)((((((((((((((...(((....)))...))))))))).((((((((((((((((((((((.(.((((((((((.......))))(((((.(((((....((((((.(((.(((((.....))))).))).))))))))))).)))))(((((((((((......))))....)))))))((((((..((((..((((.((((((............((((((..(((((((.(((((((......(((...)))..((.(((......))).)).((((.((((((..(((..((((((((((.........((((.....))))(((((....)))))..(((((.(.((((.....)))).).)))))......))))))))))........)))..))))))(((((.....))))).....))))..((((.......)))))))))))...)))))))...))))))))))))))))))))....)))))).(((((((................))))))))))))))))))))...)))).))))...)))).))))...........(((.((...(((((((((((..(((.......))).))))...((((((......))...))))..................(((((...))))).........................((.((((((((((...............((((((((((...(((.......)))...))))))))))((((((((((.(((((((((......).))))).))).)))))))))).))))))))))))....................((((((((((.......)))))))))).))))))).))))))))))))))))))))))))))))))))))).....((((((.......))))))..)))))))))).((((.((((.........)).)).)))).)))))((((...))))..)))))).)))((((.((((((.(((...)))))))))....))))......))))))))))).)))))))))))).))))))....)))))).))))))))).)))))))))))).))))))))).)))).)).)))))))))))).))))))..((....)))))))))))))))))))))))))))))))))))))).)))....(((.((((.......)))))))....((((((((((((((..((((((......))))))..))......................((((.(((((((((((((..((.(((...........(((((((((((((..((((((.....))))))..))))))..))))))).......(.(((((((...))))))).)...))).))..)))).))).))))))))))...))))))))))))......((((....))))........))))))..)))).)..)))))))..))))).))((((((...))))))))))).)))))(((((..(((((.((((((....((((((..........))))))........))))))))))).)))))(((((......))))))))))))).......
Thermodynamic Ensemble Prediction
((((((((.....(((...))).(((((.(((((.(..((((((((.{((((((((((((((.(((((.,,{{{{,,.(((.,.,,.(((((({{,,((((((,{((((((((.,(((((.(.((((((....((((((((((((((...((..(((((((((((.(((.(((((((.(((((....,,,..{((((((((.{((((((((...(((((((({..,..{(,(((((...........))))).))..,..),)))))))))))))},......)))),))))))))),....)))))(((((,((((((((.((({,,,.(((({,,.|||,...,.|.)).}))))))...)))))))).})))))....((((((((.....(((..((((((((((.(,(({.....,,|.(((.((((...))))))).,}}}....)))))))))).)))))))))))(((.(((((((((...............)))))))))...))).))))))).))).)))).....)))))))..)).))))))))))||{{((((...((((((,{((((,((({(((((....))))).)).,...((,(((((((((..(((({,(((((,({....(((((((..(((...))}.))))))).|.}}))))|,|||.{}|||}}}}}||}.}}{(((({.({,,{{{((|,((((,.((||((((({{|((|{,{{({(({|.,,{{{||||.}}}{||||{|||},|{|,}((((|.,||||{{|||{|||||||.}|..,,.,{,{||{,(({,{..||},|.,{(((,({(((,{{(..,..((((((((((((((,...))).((((((.(((((.{....((.((((((((...........)))))))).))..}.))))).)))))).((((((((((((((..(((...........)))...)).))))).))))))).....)))))).))))).......(({(((,,..||,.}||,,,|||||,|}|,}}}..{.||}..}.})))))||||||},}}},,.,},|||}}}.}}|,{({(((((({{,({.,..,{{{|||||{{,|,,.{(({({{((({...({(((..(((({,.||....)))}))}))}.}),..))))),...))}}|,,,((.,,.||,..,.|||{.||,,||(((,({{{(,((({(,{.((((((((((((((({(,,,(((((((....)))))))...((((({{((...,,(((((|,..)))))))))))}}){({{{{{{,...,}}}}|}}}.)))|,..||||}|}.....{{,((((.....}))),.....,}))))}||||,||,}}|}}.}}}}}.))}}}}.||{||||{{{|{{|{,||({{{,{||,,,{((((((((.(((((((.{,({,,..(((((((.((((((...|},|))}.)))))))|)).)))).})).)))))))}|{{.,,,.|{{||..|||{.{{{...,,,,((((({{(,{{{,.,{{..(((({..,,,||.}}..,,}}.}}},))}))),,.))),)))),,}}}})})}......(((((((((((....((((((((((((,,.,.(,..{{.,,....)).,,.})),..,))))))))).....))....))))).))))))...{{{{{|{((,,,{.......,.}))}}}}.....))))),,,.,},||||}...)))),,...,))))))}}}}}}.}}}}},}})}.||})}||||||||||||}||}|||,|||{{|||,.((((((,.....|))))},||{{{}}|||||}.{........}|,|}}}}},,,)))),(((((((((((((......)))))))).)))))}}}||||}}|||}},,))|{|||||||,(((.,.......}}}...)})))),))}))))))))..))))}}}.,||||},,|}|}}},}|||,}}{||{{|||||||,||||||(((.....))))))}|||||||}}|||},..|((,,{((((({..{{,{,{,{.,,|,)})|)),}},||}.,,}|,}}|}},.|}|||||{,|||||,....}))|}.,.(((((..((((..(((((((.,..((((({{(.((((((..{.((((.(((((((..((((({{((.(((..((,((.,.((({{((.,,(({(.{,.,({((({...||||.{|,{({{{,....,,,,||,..(((((((.,,||||}}}....)}..)),)))).)))})),}))))}),.))))}))))))..})).))}.))))).(((((((.......))))))).((((((((((.,((((({(,.,,.||,{{|,,,.||||..,..,},),}},.,,)))))).))))))))))).)))).})))))).))}.,)))..}..)))))))..))))..)))))..{(({,{{{{.(((((((......{(((,..,)))}....))))))).}))))))|||||{(({...))))|||||}}||,|,..,,...}}}}}((((.(((({{((.(((((((...{{{......}||{....||.(((((((((((...((((....))))....}...)))))},)))))..{{,,....)))))))))))))))).)))).,.,..((((((((..((((((...))))))))),.,)))).}}}.||}||,,}}))}}})),.,,}}}})|||,,,||||,|||{.||||{,.||||||||,|.{{{{,..,,,.....,|||,,,||||.|,{|{{{|||||||||}|,,,,..}))).}}}.}})))},}},,}.}}))|)))}||})})))|)))}}))}.............{(((((.(((((.....))))))))))}}}}}})}|||,||}||}......,.,..}}))))})..))}))}|,.|||,,,....|},|(((((((((...((,{....}.)),))))))))))}))))),,..,,)}){((((.((((((((((,..{(((((,(({{,(.(((((.{..((({,{{((((((({.,((((((.....)))))))))))))}.,}})))).}.)))))}).})))...)))))}||||||||{{|||||||.{|||,.|.))}|{{|(((((((({,,.{,(({.{{{,(({{{{({(((((({((((((.,((((.{,,{((,..{(|{(,.((({.......)))),)}))),)}...,)))|{{||||||,,,,,,,...,}}}))))))}))))}))))))}}),))),}}}},}|||||},,}},},,,,,},...,}}.}}}|||||||....,,,))))))),}})}})))))))))))))}|||{{,,,,,.{{{|||..}}}})}}))}}}},}))))))))).}}|||{{{.....)))}},..,.)))))})))))}))))))))))))))))))||||{|,.(((((((.((.((((((((((((.((((((((((((((((.((((.((((((((((((((((.{..(((.(((((((((((.(((((.,.........(((((....)))))((((((((......(((....)))......))))))))...................(((.((((((((...))).))))).)))(((((((({...})))))))).(((.(((((.........))))).)))..{{(((((((((((((.((((((((((((((.((((((((((((((..(((((.(((((((((({,(((((((((((((((((.((((((((((((..((.((((((((.(((((((((.(((((((((((..(((((((.{{((,,(,,.,{((((({{{{{{|||||{{{{|||||{(((({({{{{((((((((,.{{{{.(((((...........})))).,.{((({({,....)).))))||||||||.|,,,((((...((((....))))...)))).,.|}}|,||||(((((,,{{{{|||||,(((,((((((,{{{{{|,,|||{{||,......,..{{,,,{{{{{{,,,,.,..,.{.{(((((....))},}}}.,,{((({({.,.||,||{{,|{({{({({(((((,(((({.{{{(((({(({(((,,....(({{,((({{(,{{.{,.....}},}))))}}},......}}}}}}..,,,,((((({{....{{{{{{{{|,|{{..,|||||{{{,((((((....))))))...,,{{|{,.,{((((,...{((((.((((.((({{..({(.(((((((((((((((.....(((......))))))).))))))}.,{...{,,(((.(((((.((((((.((((.(((......))).)))).(((((...(((((..,(({........}}),}...)))))...))))))))))).))))))))..,.((.((((((({((....,,....,...,,.........,,..(((((((...........................)))))))..,........))))))).))....,))))})),..)))))|,{|||,||{{{{,,||||,|...,,,})))),,)))))),))))))})),))))),,))))))},||{{|||.,,......}||||||..||||||||}...,||||}}}}}|||{{{{{{{..||||...(((((.((........)).)))))..}}}},|{|||||}.....,)})))),,}},,},,.....,,,..||||..|{{,,,||||,..||||,,}}))},..}}}})}}},,{{(.{(((........)))),))}..|{{{{,,||,...)),,,)))}},})),))),,))}||||||||.,.....}}})))}},...........,,)))))}})))))))))))))))))))))))))))))))))))),,))..,))),)))))))))))))))))).))))))))).....)))))))).))..)))))))))))).)))))))))))))))))|(((((((((,...,)))))))))))))))))))).)))))..)))))))))))))).)))))))))))))).))))))))))))))).))))).))))))))))).)))..}.)))))))))))))))).)))).)))))))))))))))).)))))))))))).)))))))))...,}},,..............).))))))))))(((((.(((((((....,,|}...........,}}((..(((((.(((((((.({((((.(((((((((((....((((.......,..)))))))))((((((.((((((........,..)))))))))))).(((.((((((((,.((((((((.....)))))))).........{(((((((((((((((((((((((((((((((((.((((((((((((.((.((((.{((((((((.((((((((((((.({((((((((.((((((...........{{{{{{{(((((((((((.(((((((((((((((((((((((.((((((((((((((((......((((((.((((((((((((.((.(((((((((.(((((((.{{..{{..(((((((.(((((((((((((((.(.(((.,..............................,{{{.(((((((((((((((((((.((((((..({.(((((((((((((((((((.((((((((((.(((((((.((.(((.(((((((.(((.(.((((.(((((((((((((......((((((((..(((((((((((..(.((((.((((((.((.((((((.((((.(((((..(((((.,.((((((.((((((((.{.((((((((((((((((((.((((((((((((.(((((.((((((.((((((((.(((((((.(((((((((((((((.............,,.((({(((((((((,..((({({.(((({{{{{({((,.,.,((,,(({(,,,,,,..,|||||}|....,}}}}..,,})),.,,.))),.,||||||}}|||||||...(((((((((,,((((.({(((({((((((((..{(({({((...,,..,,,,{,..(((((..((((.(((((((((..{{(,....)),......))))))))).))))..)))))(((((({,(,(..(({{.......}})}.,},|..}||||||.....||||||(((((((((,.{(,.((((({{({((.,,{{.(((((.(({{.,((({.,,,(((({{.{,,....}))),}.||,}}|||,,||||....,..})))),,)))),.}}}}.})))}},,)).}),))}))}}})},))}))}}...|||,..,,,,||}}}})).))),},}}}}))))),..,,,},},})))).)}}}}},.,||||}},})))},,))))))))),}}))))),},)|,,|||,|.,,{({{,(((..{((({,....}}.))))..)))}))))}))))|}}}},.....,}},,((((((.....(((((((,.((({({{{,,,....))},).))).).)))))))....))))))....(((..((((...))))..)))......,,||||,||||||||....{||||,|.,|,|{{.||{{|.||,|||{{|||}|},,,.....,}})}})}))))))))}||...}},,})),.,},..((((...((((.{({..((.......,))..,}||))))..}}}}.((((((..{(((((....(((((((((.{.{{{,,{,{{,((((.....))))))}})}.}.)))))))))......,))))}}..)))))),.........))))))))))))))).))))))).)))))))).)))))).))))).)))))))))))).)))))))))))))))))).}.)))))))).)))))).,.)))))..))))).)))).)))))).)).)))))).)))).)..)))))))))))..))))))))..))))))))))))).)))).).))).))))))).))).)).))))))).))))},....|....,..((((...}))),})))).))))))))))))))))))).})..)))))).))))))))))))))))))).))))((({...))))}.))).).))))))))))))))).)))))))..}}..}}.))))))).))))))))).)).)))))))))))).))))))......)))))))))))))))).))))))))))))},((,(.,,,,...}}||.((({.({.(((((((((....((((..(((((..(({.....})})))))))))..((((.,,,,({(((((,{{{......,))),,}})))))...))))..(((((...,{((((((...(((((.((((....{,,,(((((((.{{(({,..,.((((((((........)))))))).)))).))))))....,(((({,,,|}}}}..)))),))}}}..)))).))))))))))).}}(((((....(((((...((((((((((....((((.((((((.,......|}))))).))))(((((((.{{{((((((,......)))))))}}}{(((({....}).)))))...))))))).)))))))))).((((....))))..,..))))),{{{,....}}),.))))).})))}......))))))))).}).,}||{{{.{{((({....}))},)}.(((((.(((((,{{.((((((((((...((((((((((((((({,{{{{{..{.((((({,((....))))))))......||||||{..,,,|||||||..((((((,,,,,}||||{..,,|||||{||},,}.|||||||||{((,((((((((,,((((..,(,....,|}|.,||}}}||{(({(((((((((((((((((((((({{.((((((((((.......))))(((((.(((((....((((((.(((.(((((.....))))).))).))))))))))).)))))(((((((((((......))))}...})))))){(((((.,((((..{(((.((((((............((((({..{((((((,(((((({.....,{{{..,|||,,{(.{((......}}|,||.,{((,{(((((,,{{{..((((((((((.........((((.....)))),{{({....)))}|{.(((((.(.((((,...,)))).).))))).,}...)))))))))).,.}|,,,|}|{,}|||||{{{{,.....))))).}},,)},,..||{{.,,...,))))}))))))...)))))))...}))))))))))))))))))),...)))))}.(((((((..........,.....)))))))}))))))))))))...)))).))))...)))).)))}........,))))}}|{...(((((((((({...,........,,)}))))...{||||{,..,..}...,,})}........,,|.|.,,..,,|||,,.}}}}}.,,,,,,,,...............{{{.((((((((((...............((((((((((...{{{.......)}}...))))))))))((((((((((.(((((((((......),})))).))).)))))))))).))))))))))))...........,,,......((((((((((.......)))))))))).}}}}}}}.}}}}}}}}}})))))))))))))))))))))))))}}...((((((.......))))))..)))))))))){((({.((,({(({{{{{{||{||{||}|,|||,,,,,,...}))),.,))))}.,,,{{{(,{,{|||,{|{..,)))))))))}}}}),),},}}}}))))))))))).)))))))))))}.})))))....)))))).))))))))).)))))))))))).))))))))}.)))).)).)))))))))))).))))))..{{....}})))))))))))))))))))))))))))))))))))).)))....{,.{((((.......)))))}}....(((((((((((({(..((((((......))))))..}}.........,{,....,.....((((.(((((((((((((..((.(({...........((((((((((((({{(((((,..}}}))))),..})))))..)))))))..,,...{.(((((({...})))))).,..}))).))..)))).))))}}))))))))...))))))))))))..,...||{{....}))}........})))))..)))).}..)))))))..))))).)){((({,...}))))}))))).)))))(((((..(((((.((((((....{{((((..........}))))).....,,.))))))))))).)))))(((((......))))))))))))).......

Transcripts

ID Sequence Length GC content
GGGAGAACCCACAGGGAGACCCACAGACACAUAUGCACGAGAGAGACAG… 4170 nt 0.5808
GGGAGAACCCACAGGGAGACCCACAGACACAUAUGCACGAGAGAGACAG… 9777 nt 0.5143
Summary

This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The enzyme encoded by this gene lacks a C-terminal TS motif. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease is responsible for the degradation of aggrecan, a major proteoglycan of cartilage, and brevican, a brain-specific extracellular matrix protein. The expression of this gene is upregulated in arthritic disease and this may contribute to disease progression through the degradation of aggrecan. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]

Forensic Context

A study in human prostate tissue demonstrated that the ADAMTS4 mRNA is upregulated in samples with a high postmortem interval (PMI) and is involved in enzyme and protease binding molecular functions [Javan et al. DOI:10.1038/s41598-025-29561-7]. Separately, research in human and rat skin showed that the ADAMTS4 gene is significantly upregulated (FC 20.2 in human, FC 10.0 in rat) in response to UVB-induced inflammation at the peak of hyperalgesia [Dawes et al. DOI:10.1371/journal.pone.0093338].