| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGUCAGUGUCACCUCCAGGAUACAGACAGCCCCCCUUCAGCCCAGCCC… | 1556 nt | 0.5842 |
The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis and is an important serum marker for myocardial infarction. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in striated muscle as well as in other tissues, and as a heterodimer with a similar brain isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. [provided by RefSeq, Jul 2008]
A study in rats and pigs demonstrated that the CKM exhibits analogous time-dependent expression patterns following skeletal muscle contusion, serving as a reliable biomarker for monitoring muscle injury and recovery with stable expression across species [Wang et al. DOI:10.1007/s00414-026-03727-y].