| ID | Sequence | Length | GC content |
|---|---|---|---|
| CAUUUAAAUUCUGCAGCUCAGAGAUUCACACAGAAGUCUGGACACAAUU… | 631 nt | 0.4548 |
Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. The protein encoded by this gene is a lysophospholipase expressed in eosinophils and basophils. It hydrolyzes lysophosphatidylcholine to glycerophosphocholine and a free fatty acid. This protein may possess carbohydrate or IgE-binding activities. It is both structurally and functionally related to the galectin family of beta-galactoside binding proteins. It may be associated with inflammation and some myeloid leukemias. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.