Basic Information

Symbol
CLCA1
RNA class
mRNA
Alias
Chloride Channel Accessory 1 CLCRG1 CaCC Chloride Channel, Calcium Activated, Family Member 1 Calcium-Activated Chloride Channel Family Member 1 Calcium-Activated Chloride Channel Regulator 1 Calcium-Activated Chloride Channel Protein 1 Chloride Channel Regulator 1 HCaCC-1 CaCC-1 HCLCA1 CACC1 CLCA Family Member 1, Chloride Channel Regulator Calcium-Dependent Chloride Channel-1 EC 3.4.-.- GOB5
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_001285.4
Sequence length
3004.0 nt
GC content
0.4404

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-831.00 kcal/mol
Thermodynamic ensemble
Free energy: -891.65 kcal/mol
Frequency: 0.0000
Diversity: 923.60
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((((((((...((......))...))))))))).((((...((((((..((((((............)))))).(((((........)))))))))))((((.....)))).....))))(((.((((((.((....)).)))))).)))(((((((.((((..(((..((.....))..)))....(((((((.(((..(((.(((.(......).))).))).))).)).))))).((((((((((((.(((((......))))))))(((..((((.((((........))))..))))))).((((..((..(((((.(((.(.((.............)).).))).)))))))..))))..(((((.((((.......(..(((((((..(((((((((((...((((((((.((((((((........)))))...(((((.........)))))...((((((.((((((.((((......(((((((.(((((((...(((((..((((((...))))))...))))))))))))........((((((........))))))(((.(((.((((((..(((((....((((((((((......))).......(((((((((((((.((..((((((..(((((..................((((.((.(((......))).))))))...((((..(((......)))..)))).((....((((((.(((((((...(((((.....))))).(((.((((((((.......))))..)))))))...........)))))))........(((..........)))..))))))..)).(((((((.(((....((..((((..........)))).)))))))))))).....)))))..))...)))))))))))..))))))))..)))))))....)))))))))))..)))))).......((((.((((((.(((.(((....)))....(((((((.....((((((.........)))))).....)))))))((((((((((((((..((((((((((.......(.((((((((..(((......((........)).....)))..)))))).))..).......)))))..........((((((((((..(((...(((..((((((...((..(((((((((((.((.....)))))))..))))......))..)))))))))))....))).))))))).))).((((((......((((...))))((((((....((.(((((.........((((((((((((((...((((.((((((((((((((............)))))).)))..))))).))))..(((((.((......)).))))).......((((........(((((((..........)))))))((((((...(((..((((((.((......)))))))))))....))))))..((((.....))))...)))).....))))))).)))))))..))))).))...))))))((((((((.((....)).))))))))...(((.......)))..)))))).)))))..)))))))))))))).(((((.(((((((((((((.((.((((((.......((((....(((.((((.(((..(....)..)))...)))).)))..)))).......))))))..))))))).....))))))...))..)))))..))))))))).))))......)))))))))))))).))))))))).......(((((((((.(((((((..(.(.(((....((((((((((..............(((((((((.(((.(((((((((((((..........)))))))..))))...))...)))......))).))))))))))))))))...))).).)..)))))((.((....)).)).((.(((((((((....((...(((.......))).))....))))))))).))......(((((((((.(((((((((((((..(((((((...((.((((.....(((......)))..)))).).)....)))))))..))))................(((......)))................((((((.((((.((((((......))))))..))))...)))))).(((((...((((((.(((.......))).))))))))))).........)))))))))...))))......(((.((....)))))..((((.(((((((.(((.((...........))))).))))))).))))......((((....(((((((((.(((((.....(((........(((((....(((..((((((((....(((((.((((....))))..)))))......(((....(((....))))))...)))))))))))....)))))........))).....))))).))).(((((((..((.....))..)))))))...)))))).....))))..((((....))))............)))))..)).))))))))).)))))))))))...))..(((.(((.....))))))......)))))))))...((((((.......(((..(((((..((((((((((.(((((((..........))))))).))...))))))...))..)))))..)))...)))))).(((((((.((((((.(((....................))).))))))...)))))))(((((((....))))))).....)))))))..).((((((.....))))))((((((((((...)))))))))))))).)))))........(((((.....)))))..))))))))))))))))).........))).........)))).
Thermodynamic Ensemble Prediction
.(((((((((((((...((......))...))))))))).{(((...((((((..{{(((({....,......})}})),||||{.,,,,...})))))))))|((((.....)))),....}}}){{(.((((((.((....)).)))))).))),,.,{((.((((...{({,({,..{{((,..,,.|||||{,.,.......{||.,||||}...{{{{||}}}}},},,.}},}}}...(((((((({.,.((((((((.(((({{{.,,.(((..((((.((((........))))..)))}))).((((..((..{((((.{((.(.((.,..........|)).}.))}.)))))))..)))){{((((,(((.(((..(((((.(((.,{.,{{.(({{((({{{,{(((((({(({.,(((((...,,...}.)))),}||||,.,}||..,,|||,........,.,||,....,,,,||,}..}}}.,||)},})))}))}..))))).)))))}})..}))))))}|{((({{{{{,........((((((........))))))...,||,,|,,|(({{{,(((,{{{((({{{,|{{{.,||{{||,|,{...,}}}}},.......((((((((({...(((((((.......{{......,||......)))))))..,)}}.,....{(((,(((((((((((({{{{..{{,.{{..,.{(({({.(((((((...{((((,{,..,}},|{{{{.((({,{,(,,,..,,}|||..,}})}}......}},,..))))}}}........||{..........}))..}}}}}}..||.(((((({{(((....((,.{(({.,{,,.....}}}}.}}))))))))))...,{|,{|{{{{{...|{{||{{||||{.||((({((({||{{{(...{{{{,,..,}))).{((({{,.....||{{{{{((|{{(({,,.{{{,..||||{{{.(((((((.....((((((.........)))))).....))))))),,||||||(({{{{..||{{{(((({,.,,{,.{.{(((((((,.(((......((........}}.....})),.))))))},}.,}..,.,,.)))))}.....,,,}||||{|||||}}|||}}}||},}||||||}}|||}|{{{((((,((((((..,,,,||}}||,{|},}....,{||,...,,))))))),,..}.},)}))))),)))}{|||||,|....((((...))))((((((....((.(((((.........((((((((((((((...((((.((((((((((((((...,....,...)))))).))}..))))).)))).{(((((,{,.........|||||.,,....{,|}.,,,....(((((((..........)))))))((({{,.{.(({.,((((((.({.....,)})))))))}}.,}}))))))..||||.....})))}}.}},,..,..)))))))},))))))..))))).))...))))))||||||{({{,,.,,||{|||||,.||||{(({......,,}..}}||}}.,}}}|...,})))))})))))}},.}}}}}||||||||||.}}|.((((((.......((({....(((.((((.{{{..{...,}..}}}...)))).)))..)))).......)))))).,)))))))}}}}..)))),.}})})))||||,.||||.||||{||,,..|{.,,|{|||||||{.,,.{{|||..||{|{,......,..|||,..,.,,....,,.,,,({{{{,|||{.|,.{{|,,..))),,}}}}}))),)),},,,,.{((((((((((..,.....,.)))))))..))})..|||{.{||.....,,}))}}.}))))}.}}}}|{{{{{}||||||||,||.}}})).))..,||||}},|(((((({({,,.,((...,,...,,,,.}}|,||...,}}}}}))}).||||....{.(((((.((((((((((((.(((,(((((((..,{{.((((.,...(((.....,}}}.|)})).}.}....))))))),,{{..{{{(({{....,.|..{((...,,.))}...,,,..........|{(({(,((((,((((((......))))))..,}}},,,))))}).(((((...((((((.(((.......))).)))))))))))...,.{({.{{,{({{|...{((,{,{(({.(((.((....)))))..{{{{.(((((((.(((,((.......,...})))).))))))).|}|}}}}}.}|.}}},}}}}.}}.))}...))}}})))))},,...((((..(((((((((((....(((((...,{,,..}},,))))))))},.)))))))..)))).,,.{((....))}.{{{{..|{,|{|||{{{.{{{{((,......}})))),,,,}.)))},}}...||||,..(({{{,.||{.,|||,,,..))),},))).})))))..((((....))))............{{{....}}}....}))).)))))))).)))).)))))}..,}))))),,)))))}.}},,,)))))))),))))),}.....})),},,..{((((..({(((((({(,(((((((..,....,..))))))).))}..))))))...))..)))))...{{(({...))))|..,.|}}}}))}}...............,...,.,,,,.}))))))..}))))))}.(((((({....})))))),)))))))))))))))|{((((.....))))}},(((((((((...)))))))))|((((((((((((.,.((((.....)))).,,.).)))))))))))}(((|,|.........})))........)))).

Transcripts

ID Sequence Length GC content
AACCCGCAUUUUCCAAAGAGAGAAAUCACAGGGAGAUGUACAGCAAUGG… 3004 nt 0.4404
Summary

This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans developed a multiplex RT-PCR assay for identifying rectal mucosa as evidence of anal penetration, evaluating the biomarker CLCA1 among other candidates [Akutsu et al. DOI:10.1016/J.Fsigen.2022.102712].