Basic Information

Symbol
CLDN1
RNA class
mRNA
Alias
Claudin 1 SEMP1 ILVASC Senescence-Associated Epithelial Membrane Protein 1 Claudin-1 CLD1 Senescence-Associated Epithelial Membrane Protein
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_021101.5
Sequence length
3446.0 nt
GC content
0.4129

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-915.40 kcal/mol
Thermodynamic ensemble
Free energy: -979.20 kcal/mol
Frequency: 0.0000
Diversity: 1015.07
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((((((....))))))).......((((....(((.((((.(((.((((((((..(((((.((........)))).)))...(((.....))))))))))).((((((((((((((((((.............))))))..(((((((((((((((((.(((((.....)))))...)))).))).((((((((((((((..(.(((...))).)..)))..(((((((..((((((((((((.(.(((((((((((((((((.........))))((((((((.((((.(.(((((((((((((((((..((((((....((((......))))..((((.((((((....((((((..(((((.((.........)).))).))..)))..))))))))).).)))..))))))...))))))..((((...))))...((((.......))))((((.(((....)))...))))..))))))))).)).)))))))))))))..))))))......))))))).))))))))........)))))..))))))).........)))))))))))..)))).)))))).....(((((((((............(((((((((((..........)))((((((.((((.((((((((((((......).))))))).......((((....))))..(((((((....)))))))(((.(..........).)))(((....)))((((((........)))))))))).)))).))))))..(((((...((((((((.(((((......((((...((......))....(((((........))))).........)))).....)))))((((.((((((..(((((((...............(((.(((((((....(((..(((((((..((((((.........)))).(((((((((.......)).)))))))......................))..))))))).))))))))))))))))))))..............((((((((((((......)))))))))))))))))).))))...((((.((((((.(((((((....)))))))....)))))).))))........(((((((((....)))))))))...))))))))...........))))).................(((((((....)))))))....................((((((.((((((((.....((.(((.(((((.((....((((((.((..((.....((.((((((....))))))))))..))))))))...))))))).))).))...)))))))).))))))...)))))).))..........(((((((((....))).))))))....)))))))))....................................))).))))).))))(((.(((((((..........((((((.((((((((........((((..........))))..............(((((((......((((((((.((......(((((((((((((..(((........)))....)))))))(((((((((.(((((..........(((.....))).........((.((((........)))).))................(((((((((.......((((...(((..(((((...)))))....)))...)))).....)))))))))....((((((...........)))))).(.(((((....((((.......(((((.(((((....((.((..(((..((((.(..((((((...(((....)))...(((((((((.((((((((.((((((.((((((((((((.((..((.((....)).))..)).))))((((.(((((((.(((....((.((...((((((((....((((.(((.....(((((.........))))).))).))))))))))))...)).))...))).)))))))))))..(((.....))).....((((((.((((.((((((((.....((((.((((((((.(((((.((((.(..(((((((((((............(((((((.(((.(((((((((((((((((..(((......(((((((((((((((..........(((((......)))))))))))))..(((((((((...((..((((((((.((((.(((((.((..(((............((((((.((((((((.(((.....(((((.(.............((((......)))).(((((...(((((.(((((((.((.((.((((((.........((.(((....))).))...........)))).)).)).)).))))))))))))...))))).((((..((((((((.((((....)))).))).)).)))..))))).))).))..))).)))))))).))))))((.((((.....)))))).......)))..))))))).......((((..(((((..((......))..))))))))))))))))))))).........((((((((.((...........)).))))))))..))...)))...))))))..........(((((((....(((.(((((((....))))))))))..)))))))...)))))))((((..((((((((((.(((((((....)).))))).).)........))))).)))..)))).....)))....)))))))...........)))))))))....((((.(((..(((((......))))).))).)))).((((((.....(((...((((((.....))))))...)))...))))))............).))))))))))....)))))))))))..).)))).).))))...))))))))))))..))))))))))))))))))((((((...((((....))))..))))))......)))))))))).)))).))).))).)).))).))))))...((((((((((.....(((((((....(((........))))))))))))))))))))..((((....))))....((((.(((.....))).)))).))))))..)))))..)))..)).))...))))).))))).........))))..))))).)...((((....)))).))))))))))))))....)))))).....)).))))))))........)))))))))))))))))))))...))))))).)))...))).)))).)))))))...............(((((((.....)))))))......
Thermodynamic Ensemble Prediction
......(((,{,{,,,{{||||(|....{{,||||||||..,,,.{,{{({.((((((((..(((((.((........)))).))).,.(((.....})})))))))),|,||||{{{{{.{(((((.............)))))|.(((((((((.(((((.((.((((((((..,.,{(((..((({{(({{({..((.(((((,....,{{...,,}.))))).)}..}}))}.(((((((((...({(((((.{{{({(({{{(((.{{..{{{{,((,..,.}}},.)))..))}}}}...,.))))|||))}}}))|||{..((((......))))..}}..((((,{......}},..))))..))))))).})))))),}})}||.{|{|((({(|{,}}},}.)))}}}}}|||{|.||||}}..((((...))))...|||||.,,,,,.|}}||,..,))),.)))))))).))))))).)))))))))...,|,,}||||}{{{{{{{|,.{{,{(|((((|...|,}|||,(({(({{({((((({(,{(({,.,,....(((((((((..,.,..((((((..(((.(((((((((.((..,{{.,{,..(((((..,(((..........)))|(((((.((((.((({((((((((......),,)))))).......,{,,,{{{||||..(((((({....}}))))}|,|,|.........})))))||{....}|,{(((((........)))))})))).)))).)))))}.)))))....)))........)).)))))....))))))).)))))).....))))))))).(((.((((.((((((.(((.(((((((({{(((({(({{,,...{{{(({........,,..,,,(((.{{(((((.,,,({{..{({{{((,,{({(({.......,,)))}.{{{{{{{{{......,)),)))}))}......................||,,|}}}}}}.}}}}}}}))}}}},}}}})|,{,,,,........((((((((((((......))))))))))))...,,,,}}}|{,.,,{{||{,(((((((((((....))))))).))))||{(((({{{{.,,,,..{((((({{(,,,,||||}}}})}}}}}}}}.((((({...}))))).{{{{...}}}}........(((((((....))))))).......,,..........,(((({{,{{{||||,..,,,.,,(((((((((.({..{.((((((.{,..{{.....{{.{{{{{{....})))}))}))..,}))))))...},,}.))})))}))}..||||||}}.}}})}}..,}},..,,}},,........{((((((((....)))},))))).,,},)))}}))))}).,.....,,,..,,..........,,,.,,,,,|||,...}},..}}}}}})))})))}.,)))))))))))).)))))))))...)))))))..}}},,.,)))))))},..,,,)}}||||{,,.}}}},}}||{}|}||{{||||||,...,,,,.(((((((..(((........)))....)))))))}||||||||,|{|||.....,,{.||,||,..{|||..||{{...{{.{(({.....,,.)))).}).........,......,{||{||||,,..}})||||.,||||||(({({|,,||||,,,,,|||,.,{{||....,||,,,,,,},},,{(((((...........)))))}...,{{{{....,,{{......,(((((.({{{{...,{{|{({,|{{,.{{{{.{..,{(((({({,,....,)))|}|(((((((((.(({{{{({.((((((.(((((((({((({(({,...{(,{,{|,.,{{{||.,..,|||{,{|,.|||.,}},}},,..{{...((((((((,...{(((.(((.....{((((,{.....,.))))}.))).)))))))))))).,.)),},....,|||||||})}}}},,{((,,.,.|||,,...{(((((.((((.((((((((.....((((.((((((((.(((((.((((.(..(((((((((((..,,,,...,,.(({{{{,.|||}|((((((((((((((((..{{{...,,,{(((({{((((((((..........(((((......)))))))))))))..(((((({{({{.{(..(((((((,{((((.(({(((((..(((,,,,........((((((.((((((((.(((.....(((((.(.............((((..,,.,|}||,(({{{.,{(((((.(((((((.{(.((.((((((.........,{.(((....})}.}}...........))))},).)).)}.)))))))))))),..})))}.{|||..{|||{|{{.||{{....))}}.|||,}}.}}}..))))).))).)}..))).)))))))).)))))){{.((((.....))))},...}},.)))..))))))).......((((.,(((((..((......))..))))))))})))))))))))).........(((((((({{{.........,,},.))))))))..)),,.})}...))))))......{{{{(({{,,,.}}}|{|,(((((((....)))))))}},..,,,,}}},.,}}}}}}}(({{..{{{{{{{{,,.(((((((....)).))))).}|}........})))).)))..}}}}.....}))....)))))))...........)))))))))....((((.(((..(((((......))))).))).))))..,,,,,.....(((...((((((.....))))))...))),.{|||,,,..,,,.......,.},,}))))}}....)))))))))))..).)))).).)))),..))))))))))))..)))))))))))))))))|{|||||,,.|{{{....}}))..))))))}.....))))))))))}}))).})}.}}|.}},||||{|}||}...((((((((({.....((((((({...,{{........}}))))))))}}}}}}}))}..,(((....)))|(({.((((.(((.....))).)))).))))}},||},}},}))},.}},}}...}}))}.}}}},...,,,,,,,|||..}},,,.}.,,}.{|||||||,,.,|,,|||}}}},,,}}}})))),.......,...,,,..,}},})}}}))),,,))))},})))),,}},,)))))...,.})})))))))}})},,,,}))........,,,|,,,|||||||,.,,,}},},}),}}},.

Transcripts

ID Sequence Length GC content
GUCUCAGUUCCCGAGCCUGGGAGCAACCGCAGCUUCUAGUAUCCAGACU… 3446 nt 0.4129
Summary

Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. Loss of function mutations result in neonatal ichthyosis-sclerosing cholangitis syndrome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that hyperoxia exposure significantly downregulated the mRNA level of the CLDN1, suggesting alveolar dysfunction [Shimada et al. DOI:10.1007/S00414-008-0226-6]. In an experimental porcine model for bruise age determination, the expression of the CLDN1 in subcutaneous fat showed variable regulation following high-force impact trauma [Barington et al. DOI:10.007/s12024-017-9869-2].