| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAAGUGUUCUCUAUCGGCUGCAUGCCUAGACCACCAAAGCGUUCUGACC… | 2448 nt | 0.4044 | |
| GAGCCGGAGAGCGAGCGCGGCUGCAGCCGGCGGCAUGGCUAGCACGGCU… | 2466 nt | 0.4120 | |
| AAAGUGUUCUCUAUCGGCUGCAUGCCUAGACCACCAAAGCGUUCUGACC… | 2505 nt | 0.4056 |
This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The expression level of this gene is associated with recurrence of primary hepatocellular carcinoma. Six alternatively spliced transcript variants encoding different isoforms have been reported, but the transcript sequences of some variants are not determined.[provided by RefSeq, Jun 2010]
A study in rhesus macaques demonstrated that the CLDN10 transcript was among the top dysregulated genes in lung tissue following whole-thorax irradiation, being upregulated as a common differentially expressed gene in irradiated animals and associated with acute and chronic lung injury and epithelial-mesenchymal transition [Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058]. In a mouse model of traumatic brain injury, spatial transcriptomic analysis found the CLDN10 gene was downregulated in the neocortex, corpus callosum-external capsule, and striatum at two days post-injury [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528]. A study in rhesus macaques demonstrated that whole-thorax irradiation induced significant transcriptomic dysregulation in lung tissue, with CLDN10 identified as one of the top upregulated transcripts among common differentially expressed genes in irradiated animals, associating it with acute and chronic lung injury and epithelial-mesenchymal transition [Priyanka Thakur et al. DOI:10.1016/j.ijrobp.2021.03.058].