Basic Information

Symbol
CLEC2B
RNA class
mRNA
Alias
C-Type Lectin Domain Family 2 Member B AICL HP10085 CLECSF2 C-Type (Calcium Dependent, Carbohydrate-Recognition Domain) Lectin, Superfamily Member 2 (Activation-Induced) IFN-Alpha-2b-Inducing-Related Protein 1 C-Type Lectin Superfamily Member 2 Activation-Induced C-Type Lectin IFNRG1 C-Type Lectin Domain Family 2, Member B IFN-Alpha2b-Inducing Related Protein 1
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005127.3
Sequence length
1533.0 nt
GC content
0.3653

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-346.70 kcal/mol
Thermodynamic ensemble
Free energy: -378.85 kcal/mol
Frequency: 0.0000
Diversity: 410.75
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.(((...((((((.((((((((((..........(((((...((((.........))))....))))).(((((....)))))((((((.((.((.(........))))).))))))(((((......)))))....(((((((..((((.........))))....))))))).((((((((((.((..(((((........)))))..)).))))))))))....((((((((...))).))))).....(((((((((((..(((((((.((......................((((((((((((((.((((((...(((.......))))))))).))...((((((.((((.................((((((......))))))))))))))))(((((.((((((.((((((..((((..(((..(((........)))...)))..)))).))).))))))))).))))).(((((...)))))...(((((((((.((((((..(((........))).....((((.((((.(.....).)))).))))(((((((((.((((((((((((......((((((....((((((...........................))))))...)))))).((((((((..((((..(((.((((......)))).)))....)))).)).)))))).........(((.(((..(((((.........((((.((....)).))))......)))))))).))))))))).)))))))))))))))..)))))).)))))))))..................))))))))))))....)).)))))))....))))))))))).......)))).))))))..)))))))))..(((((((......)))))))........))))).(((..((((.(((((((((..........((((.....(((....))).....))))........((.((((((......(((..((((.....(((((((((....(((......((((.(((..................((((((((((....((.(((((((..(((((....)))))...((.((........)).))((((((..(((....(((((((((........))))...((....((((((.....((((((((((((.(((((((.......)))))))....((.(((((.(((((..........)))))..)))))))...............)))))...))))))).......))))))...))((.....))....))))).....)))..))))))...))))))).)).......))))))))))..(((((((((((((.....((((................))))......)))))))))))))....))).))))..)))....))))....))))))))).)))..)))))))).))))).)))).))))..))).........
Thermodynamic Ensemble Prediction
(({,,.,{{{{,(({{((,(((({(((((..........(((((.,{{{{{,......,,}},}.,,.})))},{(((({,.,|||||((((((.((.((.{........})))).)))))}{{(((......|))}}....(((((((..({{{.{.....,,)))}....))))))).{{{{{((((({((|.{,,,|,,..,,,,))))),,||{|||||||||,....{{((({{{...})).))))}.....(((((((((((..(((((((.{{....,{{{{....|},,,....((((((((((((((.((((((...,((....,,.,,,)))))).,,...{(((((.((((...,...........,.||,(((,,....,))))))))))))))|(((((.((((((.((((((.,{(((..(((..(((........)))...)))..)))).))).))))))))).))))),(((({...}))))...(((((((((.((((((.,(((..{{{(((....))).))}},|||{,{{......)))}.,...(((((((((.{(((((((((((......((((((.{{.{(((((,,,......,........,,.......))))))}}.)))))).((((((((..((((..,((.((((......}))).)))....)))).)).))))))....,,...{{{.(((..|{{{|,,,......((((.,{....)}.))))......}}}},,)).}}})))))).)))))})))))))))..)))))).))))))))).......,,,}}}}}}}}}}}}}}},,,,,....}).)))))))....))))))))))).....,.}}}}.}}}}||.,,|}|||,(({,{{{{(((,,{{..,.|||,,{,.,,,,.}},}}|{(({{((,,.,,,|,,|||}}|..,{,...|||.....||||||||},.....,|,,...,,{,,,,,,{{{{({((((((((((((...((((((((..{(..((.,,.....}}..)).,,)))))))}.,{{.,{{((.......{{{..........}}}.....,)))))},},},,..)))))),.......})))))),.{|||||,..{((((((,({({{((,{{..,{{({{,....})))),|.}}..(((((|{{((((.(((((((.......)))))))..,.{{,{{{((.(({{{.......,..)))))..))))))}..,,},.........)))))|{,{||||,|{{,.....{{{{,.,.,|{{,....,,..})))}............,,,{{{{{...(((((.....)))))...})))))...(((((((((((((.....((((................))))......))))))))))))),,,....|||}}..........,,,.....)))))))))}},...))}})))})))))......}}}},,}}}.........

Transcripts

ID Sequence Length GC content
GGUAUACCUCUAGUUUGGAGCUGUGCUGUAAAAACAAGAGUAACAUUUU… 1533 nt 0.3653
Summary

This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may function as a cell activation antigen. An alternative splice variant has been described but its full-length sequence has not been determined. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]

Forensic Context

A review of transcriptomic studies in human populations reported that CLEC2B, along with other transcripts such as ARL4C and ZBP1, was found to have novel ethnic-specific mRNA isoforms in lymphoblastoid cell lines derived from CEU (European) and CHB (Han Chinese) populations [Daca-Roszak & Zietkiewicz DOI:10.1007/s13353-019-00510-1].