| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGUAUACCUCUAGUUUGGAGCUGUGCUGUAAAAACAAGAGUAACAUUUU… | 1533 nt | 0.3653 |
This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may function as a cell activation antigen. An alternative splice variant has been described but its full-length sequence has not been determined. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
A review of transcriptomic studies in human populations reported that CLEC2B, along with other transcripts such as ARL4C and ZBP1, was found to have novel ethnic-specific mRNA isoforms in lymphoblastoid cell lines derived from CEU (European) and CHB (Han Chinese) populations [Daca-Roszak & Zietkiewicz DOI:10.1007/s13353-019-00510-1].