Basic Information

Symbol
CLEC4D
RNA class
mRNA
Alias
C-Type Lectin Domain Family 4 Member D Dectin-3 MCL CLECSF8 CD368 Mpcl C-Type (Calcium Dependent, Carbohydrate-Recognition Domain) Lectin, Superfamily Member 8 Dendritic Cell-Associated C-Type Lectin 3 C-Type Lectin Superfamily Member 8 C-Type Lectin-Like Receptor 6 DC-Associated C-Type Lectin 3 Dectin 3 CLEC-6 C-Type Lectin Domain Family 4, Member D Macrophage C-Type Lectin C-Type Lectin Receptor CD368 Antigen CLEC6
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_080387.5
Sequence length
1973.0 nt
GC content
0.3771

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-481.70 kcal/mol
Thermodynamic ensemble
Free energy: -521.56 kcal/mol
Frequency: 0.0000
Diversity: 619.99
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.............(((((.((((((.((((..........(((((((((((.....(((.((((((.((((((.(((((...(((((..((((..((((...)))).........(((.(((.((((..(((((((.....((((((......((((.......)))))))))).......((((....))))..(((((((......((((((.......(((..((((((((..((((.....((((..((....)).....))))..(((.((((.((((((.....))))))..((((.((((((......(((((((..((((((.((((((.(((((((((..((((...))))))))))).....)).)))))).)))))))))))))...)))))).))))..(((((.........)))))..........((((.(((....))).)))).))))))).))))..))))))))..)))((((((((....)))))))).........(((((((((((((.((........)).)).)))))).)))))....)))))))))))))(((((((((((((....)))))..(((((((((((.............))))))))))).......(((.(((.((((((..........)))))).))).)))...(((.(((((((((((.....))).))))))))..))).((((((..((((((......))))))..(((((......)).)))......))))))...(((((........)))))...))))))))..((((.((((((..(((..(((...((((((...)))))).))))))..)))))).))))...........)))))))......)))).))).))).))))..))))).....))))).)))))).)).........((((.....((((.(((........))))))).....))))..)))))))....))))))))))))))).)))))).)))))(((((..(((((...........((.(((((..(((.((.(((((((((((..((.((((((((..(((((((....)))))))..((((((((.(((((((((...(((((.((((........)))).)))))))))))...)))..))))).)))..(((.(((((((.....))).)))).)))(((.(((..((...(((.....)))...))..))).)))...........(((((((......))))....))).........)))))))).)).......))))))))))).)).((((((((((((((((.....(((........))).((((..(((((......((((..(((...((((((...........(((((((((((..........)))))))))))....))))))...)))..))))............(((((((.........((((((....(((((.....((((.(((((((((....)))..))))))..))))............((((......((((((...((.((((((((((.(((((.....((((((.....))))))....))))).))(((....))).............)))))))).)).(((.......)))))))))......)))).((((((....(((((..(((.......)))...)))))..))))))..)))))..)))))).((((((.(((((((.(((((((((......))))))........))).))))))).)))))).......((((((((....)))))))).........))))))).)))))..)))).((((((((.......))))))))..))))))))))))..))))...)))..))))).))...........)))))...)))))........
Thermodynamic Ensemble Prediction
((({{..,,.{{((,,,(,.(((((((((......((((((...})))))})))))))},|,,,{,{{{,....{((((.{{,,((({{((((..((({...}))}.{{.((((.,,.{((,.((((.{((((((......(((((({,....{{{{.......}}))))))))......}}}}}...,}.))}},,}||...}}}}.||..,..}}},....}}}}|,|||)).}}|}|.....,,,,..|||...}}}},||))))}.{((,,,,,{((({{{.,{{.,}))),.,,)})}.,|,,,,,.,,,,{{{(({..((((((.((((((.(((((((({.,((((...))))))))))).....)).)))))).)))))),)))))}|..,{{..{((,({{{{({....{{.....,)).,....,,},..((((.{((....))}.)))},{{,,,},})|(({.,{{{{|||{{...((((((({....})))))))....,{{{,.((((((((,,{(.{(........)).)|{||||||{}}|||{{.,{({{,{(((|{{(((((({,{(((({,.,,,||}}..(((((((((({...........,.}))))))))))....,,.|((.{{(,((((({{{,,,...,,}}}}}|,}}}.|}}...|||.{((((((((((,....))}}}))))))}..}}},{{{(((,.({((((......}}}))}..({{{{,,,{..,|,|}}......)))}))}}}|{{{|,,,.,..,))))}.,,})))},||{{((((.((((((..(((..{((...((((((...)))))).)),)))..)))))).))))...}}}}....}}}}}..}}}}}}}}|{{{,((|...{{{..,{{{{....,,,{,.....{{{(({..{{{.,,..{||||,|,,{{,{.|{{,,,,..,{|||,,,,...}})))),}}},})},...{||,||{||||,||||{|||||..,,.))}}}}}}}(((({{{{{{..{{{{,{{{{{{{,,,{((((.(((((((((((..{,.((((((((..(((((((....))))))).{((({(({{.{{{((((((...(((((.((((........)))).)))))))))))...}}},,}))}}.}}}|.(((.{((((((.....))).)))}.)))(((.(((..((...(((,...,))}...))..))).)))..........,{{{{{{({{{,,.}}}}....,,}.,.....,.)))))))).},...,...)))))))))))}))}}.((((((,{,.,,,...}}}|||.......,},),.,||},}||,.}}}},,||}}}.((({,...|})))..........(((((((((((..........)))))))))))..,.},))))}}},))}.,)))}}}....,,,,...}}}}}.}})...))),)}}{,{{(((({{,||,,||||.|||||||||},.}))).,))),})}})))}.,}})).}})}}))))}},...{(({(({,,({.((((((((((.(((((.....{(((((.....))))))....))))).)},{{....}}}............,)))))))).}}..,|...,,,.))))))))},,.{{{,,,|{((((((....(((((..(((.......))}...)))))..))))))...})...})),))..((((((.(((((((.(((((((((......))))))........))).))))))).))))))...,{,.((((((((....)))))))),},.}}}}},}},|{(({.((((((|...((((((((.......))))))))...})))))).)))}},}..})))))}.)).,)}),............})))))),)))..}},....

Transcripts

ID Sequence Length GC content
GCCUCAUCUCCCGGAAUGUAUCAAAGGAAACCCCUGUCUUUGAAAAAGA… 1973 nt 0.3771
Summary

This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans using single-cell RNA sequencing of peripheral blood mononuclear cells from acute myocardial infarction patients demonstrated that the CLEC4D was profoundly upregulated in intermediate monocytes from patients without plaque rupture, where it was associated with neutrophil activation and degranulation pathways characteristic of plaque erosion [Jun Qian et al. DOI:10.3389/fimmu.2022.908815]. A study in mice demonstrated that the CLEC4D gene was upregulated in common in spleen leukocytes across all three injury models of trauma/hemorrhage, burn, and LPS infusion at the 2-hour post-injury time point [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. This transcriptional response was part of a larger common early signature to systemic inflammation, with the majority of differentially expressed genes assigned to immune response and cell death pathways, and the upregulation of a cohort of these genes was validated by RT-PCR.