| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCUCAUCUCCCGGAAUGUAUCAAAGGAAACCCCUGUCUUUGAAAAAGA… | 1973 nt | 0.3771 |
This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
A study in humans using single-cell RNA sequencing of peripheral blood mononuclear cells from acute myocardial infarction patients demonstrated that the CLEC4D was profoundly upregulated in intermediate monocytes from patients without plaque rupture, where it was associated with neutrophil activation and degranulation pathways characteristic of plaque erosion [Jun Qian et al. DOI:10.3389/fimmu.2022.908815]. A study in mice demonstrated that the CLEC4D gene was upregulated in common in spleen leukocytes across all three injury models of trauma/hemorrhage, burn, and LPS infusion at the 2-hour post-injury time point [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. This transcriptional response was part of a larger common early signature to systemic inflammation, with the majority of differentially expressed genes assigned to immune response and cell death pathways, and the upregulation of a cohort of these genes was validated by RT-PCR.