| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCAUUCUCCCUGAAUCUUACCAACAAAACACUCCUGAGGAGAAAGAA… | 1996 nt | 0.4068 | |
| AUUCAUUCUCCCUGAAUCUUACCAACAAAACACUCCUGAGGAGAAAGAA… | 2101 nt | 0.4127 |
This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type II transmembrane protein is a downstream target of CCAAT/enhancer binding protein (C/EBP), beta (CEBPB) and may play a role in inflammation. Alternative splice variants have been described but their full-length sequence has not been determined. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that CLECSF9 (C-type lectin, superfamily member 9) was identified as a gene upregulated in common in spleen leukocytes across three distinct models of injury and inflammation—trauma/hemorrhage, burn injury, and lipopolysaccharide infusion—at a 2-hour post-injury time point [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. This upregulation was part of a common early transcriptional response involving immune response pathways, as determined by microarray analysis and validated for a cohort of genes via RT-PCR. A study in mice demonstrated that C-type lectin domain family 4, member e (Clec4e) was significantly upregulated (567.100-fold) in skeletal muscle at 12 hours following an incised injury, as identified through DNA microarray analysis for forensic wound age estimation [Mohammed Hassan Gaballah et al. DOI:10.1016/j.forsciint.2016.06.027]. In a separate investigation using human and rat models of UVB-induced inflammatory pain, the orthologous gene CLEC4E was also found to be upregulated in skin (human FC 21.5, rat FC 19.0) at the peak of hyperalgesia [Dawes et al. DOI:10.1371/journal.pone.0093338].