Basic Information

Symbol
ADAMTS7
RNA class
mRNA
Alias
ADAM Metallopeptidase With Thrombospondin Type 1 Motif 7 ADAM-TS7 A Disintegrin-Like And Metalloprotease (Reprolysin Type) With Thrombospondin Type 1 Motif, 7 A Disintegrin And Metalloprotease With Thrombospondin Motifs-7 Preproprotein A Disintegrin And Metalloproteinase With Thrombospondin Motifs 7 DKFZp434H204 ADAM-TS 7 ADAMTS-7 COMPase EC 3.4.24.82 EC 3.4.24.- EC 3.4.24
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_014272.5
Sequence length
5520.0 nt
GC content
0.6556

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2527.00 kcal/mol
Thermodynamic ensemble
Free energy: -2613.85 kcal/mol
Frequency: 0.0000
Diversity: 1402.79
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......................((((...............((((((((.(.((...(((((((((((((((((((((.((.((..((((((((((((((((..((.(((((..((((..((((.((.((((.(((...((((.(((((((((.(..(((((((.((((....))))...((.(((.......))).))...(((..(((.((((....)))))))..))))))))))..).)))))))))))))..))))))).)).)))).((((.......))))))))..)))).).))..)))))))).)).))).((((((((((((((....(((((..(.(((.((((((((((((..((((........)))).)))))...(((((((.(((((((((........)))))...((((((((((((((.((((((((..(((((.....)))))..)).....(((((((((....................))))))))).((((((((((.(((...((((...(((((..((.((((.(((.(((((((((.((.(.(.(.(((((((.(((((((.((((((.(.((((.((((((..((((((....(((((.((((((...)).)))))))))(((((.......)))))((((....)))).((((.(((......)))))))..)))))).....((((......((((....))))...)))).))))))..)))).)))))))))))..))).))))..))).).).).)).)))))).))).))).))))))..)))))....)))))))((((((((((((...)))))((.(((.((((....))))))).)).))))))).(((((....)))))))))).))))).)))))))))).)))))))))).(((.((((.(((.((.(((((((((((.....((.((((((((......(((((........))))).....((((....))))((.((((.(((((((...)))).))))))).)).(((((((((.(((.....))))).))))))).((((....))))....)))))))).)).....(((((((..((((((.((((....((((.((((((.....................(((........)))..((((((((((.....)))))..))).))..((((..(((((((....)))))))....))))......)).)))).))))))))..)))))).)))))))))..)).)))))))))))))))))))((((...)))).((((((.(((....))).)))))))))).((((((((......(.((((.((((......(((((((...(((((.((((........)))))))))...)))...)))).(((.((.((((((.((((.((.(((..((((....))))..))).))))))(((...((((...))))..))))))))).)).))))))))))))))))))))((((((.....(((.(((((((...(((...))))))))))))).)))).))....((((....)))).....))))))).))))))))))).)))))((((......))))..((((((((.(((.(((((....(((((((.(((((..(((.(((...((((((.(......(((.((.((((((..((((((..((((((....)))..)))(((((((((....))))).)))).)))))).)))))))).))).....).))))))))).)))))))).)).)))))(((((...)))))))))).)))..)))))))))))))))..)).)))))(((((..((((..((.((.((((((((.((((((...(((((((.((((((((((((.(((((((((((.............((((((.(((((((((((((((....))))..)))))..))....((((((....(((.((((((((..(((.(..((((..(((((..((((((..(((.(.((...(((((.....(((((.(((((((.((.((((...(((........)))...)))).)).)...))))..)).)))))......)))))...))).)))..)))))))))))..))))..).(((((.....)))))..)))..)).)))))).)))...))))))...)))).)))))).....))))))))))).............((((((((....((.(((((((((((((....))))))))...)).))).)).....))))).)))((((.((((((.(....)))))))))))((((..(((((((((((((((..(((((.(((((((.(((...((((((.(((.(((((((.((....)).))))))).)))...))))))((.(((((((((((.((((((((((((((((((((((((((((((.((((..(((((((....((((((......))))))...........(.(((......))).)..........)))))))....))))...))).......))).)))))))))))))(((((........)))))((((.(((...))).)))).....((((((((((((((((....((..(((((....(((((((............)))))))...)))))..)).....)))))))))(((...(((((((((((((((........))))))...(((((.((((((.((((.(..((.((((((((...........(((...(((((((((((((...((..((.(.(((.(..(((((((...(((((((((.(((((((((..(((.(((...))))))((((((.(((.((((((..((((((...(((((..(((((((((.((..((((.....))))...))))))))))))))))........(((.(.(((....))).).)))..............(((((.((((..(((....(((((((.((((.(((((((..(((((((((((.(((((((..((.((((((((..(((....)))..)))....)))))))..))))...))).)))))).)))))........)))))))..((((((..(.(((((((...((((((.((((.....(((((((.((((((((.(((((((((.....)))))))((((((((...(((((((..(((((((((..((((((((.......((((.....((((((..............................)))))).....))))))..))).)))..))))).))))..).))))))...))))(((((((((.....((((((((((..............................)))).)).))))))))))))).(((.((((((((....(((.((((.((((((((((..((((..((((((....(.((((......)))).).....((((((....)))))).(((...)))..((((((.......)))))).)))))).))))..)))).))))))((((..(((((((....)))))))..))))...........((((((.((((.....(((...........))).....))))))))))......((((....))))..)))).))))))))))).))).))))..))))))))))...)))))))))))..((((....)))).......)))))).....))))))))..))))))..((.((((........)))))).......)))).)))))))....))).))))..)))))..)).))))..))).))).)))))))))....)))))))))))).....((((.....))))..((((.((((.((((((.(((((.(((((...((..........)).)))).)..))))).)))))).)))).)).)).((((((((((((.((((....((((((((((.((.(((.(((.(..((((((......(..((((........))))..)......))))))..)..)))))).))..(((((..(((((..((((((.......))))))))))))))))....))))))).)))..((((.((((((((..(.(((((((..((((((((.......))))))))(((((....(((.((((((....)))))))))...((((....)))).....))))).(((((((((((((((....))))).).......)))).)))))(((((((.((......)))))))))...))).)))))..))).)))))))))..))))..))))))))))))))))))....)))))))..).)))).)))))))))))))))))...)))(((((((.((((((....((((((....))))))(((....)))....((((((((((...((((((.((......)).)))))).......)))))))))))))))).)))))))((((..((((.(((((........)))))...(((((....)))))...)))).))))....))))))))))..(((((((.(((((..((.((((((.(((.((.(.(((((....))))).).)).))).).))))).))..))))).))).)))))))))))))))..))))))))))))))(((((....)))))..))).((((......)))).....))))))))))))))))))..(((((((..(((..(((......((((.(((....))))))))))..)))))))))).(((.((((((((((.((((((.((((((..((((((((..(((((((..(.....)..)))))))))))))))..((((((........)))))).)))))).))).)))))))(((((((.(((..((((....))))...))).)))).)))(((((...(((((..((.(.(((.(((((.((((.(((......)))...)))).)))))))))..)))))))....)).))).)))))).))).....(((((....))))).)))))))))))))....)))))))))).))))).......))))..)))).))))))))))).))))))))))))))))))).)))))))))))))).)).....((..((((((((((((........))))))).)).))).)).))..))))..)))))..........)))..)).)).))))))))).))....))))))))))(((((.....)))))................))).)))).)))).(((((.....)))))...((((((....))))))..........((((((((((.(((......))).))))))))))))))...............
Thermodynamic Ensemble Prediction
.......................((((...............(((((((({(.(((,.(((((((((({{((((((({,.{|||||,((((((((((((((((..((.(((((..(((({,((({,(({(((,((((...((({{(((((((((,{|||,|||||.{{{{,,..}}||,{{{(,((({.{({..|{|{||...{|||,{{({((((,...)))|})),|))|)))))),,,},)))))))))))))..)})),)},)).)))),||||....}}.))))))),..)))).).))..)))))))).)),)))|(({(({(((({{{{,{{,({(({..|,{{.,((((((((((((..((((.,......)))).))))),..(((((({.(((((((((........}}|||.{,(((({{(({(((((,((((((((,,(((((.{{,...{((((((.....((((((((((.{,,.{,..{.{{{{....,|||||||,{((,({((({{,..,,|,..{,....,|||.,..))),)))}}))|..}})}}.})}})}.,.)))||||}|(((((,.,,||||}|}||||,,{((((,,,,,,,|..}}||||,|{|||||,,.}),})))))})){{||{.,,,,,,)))||((((....)))).((((.(((......)))))))..}}}}}|,,{{{({{(,,,{{.((((....)))).}})})|,|}})}}||}}))}||))))}||||,{|||{||||{{},,...}},}))}},,,.),)))}}||||||,.|{{||||,{.{|||}||{|({{{{{,(((((,,,}}}},,{.|||,||||....})))))}.})))))))))||,,||}}.,)))))}}}}).))})),)))}|)))}).})))))}))),(((.((((.((,,((.(((((((({{{.....((.((((((((.{.,,,(((((........)))))....,((((....))))((.((({{((({({{...,})}.)}})))}.}}.(((((((((.(((.....)))))}}}))))).(((|....})))...,)))))))).)).....{((((((..((((((.((((....((((.((((((.............{{,...,}|,{........,}}..{,((((((((.....)))))..})).))..((((..(((((((....)))))))....))))......)).)))).))))))))..)))))).)})))))}}..}),})))))))))))))))))|((((...)))).((((((.(((....))).))))))}}}}.((((((((......(.((((.((((....,.(((((((...(((((.((((........)))))))))...)))...)))).{((.((.((((((.{(((.{(.(((..{(((....}}))..))}.))))))(({...{(((...))))..))))))))).)).))}))))))))})))))))),|||||,....{|||{(((({{..,|||.,})}})))))))))).}})}.)}....{||{,,,.)))}.....})))))}.}))))))))}}.)))))||||,,....)})),.((((((((.{((.(((((....((((({{,((((({.(({.(((...((((((.(......(((.((.((((({,.((((((..(((((,....))}..}},(((((((((....))))).)))).)))))).)))))))).))).....).))))))))).)))))))).)}.)))))(((((...)))))))))).))}..))))))))))))))),.)).))))}|||||,.{{((..|,.((.((((((((.((((((...((((((,{((((((((((((.(((((((((((.............((((((.(((({{((({(((((....))))},)))}},,||....{(((((....(((.((((((((..(((.,..((((..(((((..((((((..(((,(.{(...(((((.....(((((.(((((((.((.((((.,.(((........))).}.)))).)).}...))))..)).)))))......)))))...,)},)))..)))))})))))..))))..}.{((({.....})))}.,)))..)).)))))).)))...)))))}...}))).))))))..,..))))))))))).{{((({,.,{|.((((((((....((.(((((((((((((....))))))))...)).))).)).....))))).)))||||.,{||||}}}{{{||,,,)))))|(((,.{(((((((((((((((..(((((.(((((((.(((...((((((.(((.(((((((.({....,).))))))).)))...))))))((,(((((((((((.,((,((((((({{(((((((((((..,{{(|{|{{..(((((((....((((((......))))))........,,.{.,,{,,||..}||{{.,...}}}..))))))){,|||},,...))},||||,|})),}}}}}}}})}}}}(((((,,.,,..{|||||((((.(((...})).)))).,}}.|||||{{(((((((((....((..(((((.{..(((((((,{{....)}.,.})))))).,.)))))..)).,...)))))))))(((((.(((((((((((((((........))))))...(((((.(((((((((((.{(,((,((((((((...,{,,,..{(((,{,(((((((((((((...((..((.(.(((.(..(((((((...(((((({((.(((((((((.{,(({{({,{,|||||{((,,,,,|,({(((((({{,,,,.|}}.|||||}}(((((((((.({..((((.....)))),,.,,))))))))).})))}}}}}.,.}}}.|,{......{{{{.{|||{{,,,.,.......(((((.((((..(((....(((((((.((((.{(((((({{(((({{(({((,{((((((..{(,({((({((,{((({,,,,||..,.},},.})))))),,})))...))},))}))).)))}),,.,}}.,)})))}),,||{{((,,(,(((((((...((((((.(((,....{(((((((.((((((((.{{(((((((.....))))))){{{{((((...(((((((..(((((((((..((((((,{.......{{{(.....((((((.....,,.........,,............)))))).....})))}...))).)))..)))))}})))..).))))))...))))(((((((((.,,{{((({(..,{{......,..................,,,..}}|||...,)))))))))))).(((.((((((((,...{((.((((.((((((((((..((((..((((((....,.((((......)))).|.....((((((....)))))).{{{...}))..((((((.......)))))).)))))).))))..)))),})))))((((..{((((((....)))))))..))))...........((((((.((((.....,((,....,...,.,,,...,,))))))))))......((((....))))..)))).))))))))))).))).}}}}..})))))))))...)))))))))))..((((....)))).......)))))).....))))))),..))))))..((.((((........)))),),......)))).)))))))....))).))))..))))).....})))..,,,..))}))),))))}....)))))))))))}.....((((.....)))).,{{({.((((,((((((.(((((.(((((,,.,,..........)).)))).)..))))).)))))).)))).)).)).((((((((((((.{{((.{{{((((((((((.((.(((.(((.{..((((((......{..((((.{....,.))))..}......))))))..,,.)))))).))..(((((..(((({.,(((((({(....}))))))))))))))))....))))))).)),..((((.((((((((..(.(((((((.,((((((((......,}))))))}{{{{{....(({{((((((....))))))))).,.((((....)))),,,..}}))),((((((((({(((((....})))).}.....,.)))).)))))(((((((.((......)))))))))...)))}}))))..))).))))))))).)))}},.))))))))))))))))))....)))))))..).)))).)))))))))))))))))...|||((({(((.,(((((....((((((....)))))){{,,,,,)}),,.(((((((((((...((((((.((......)).)))))).......)))))))))))}}))),)))))))|,,{||{|||.(((((........)))))...(((((....))))).}})))..,,)).,,.))))))))||{{({(({({{((((({{((.{{{(((,{{,.||}|.(((((....)))))}),))})))}}}}))))})}..,,}}}.)))}),})}))))))))))..))))))))))))))(((((....)))))...,,))))}.,,||{|||.{{{.{||||||,|}||}|||}||,,({(((({,,{((,,(((.,.,,.((((.(((....)))))))}}|,.|||}}|||||.((.{((.(,(((((.((((((.((((((..((((((((..(((((((..{,,...,,,)))))))))))))))..((((((........)))))).)))))).))).)))))))),).))}.|||..((((....)))),,,}}}})}))},))},}))}})},.}}|}||||,{||{(((((.((((.(({,,....))),,.)))).)))))).,,|{{{|||||{..|{||||}|||},,{{{|||..,}}))))..)))}}))))))))))))))))....)))))))))).))))).....,.))))..)))),})))))))))).))))))))))))))))))).)))))))))))))).))...,,{,..((((((((((((........))))))).)).))).)).,),.)))),,))))}.,,,.,,,|,}}||,|,.}}.)))))))))})),}..))))))))))|.)))}}...(((|...,,,...............)))).)))).(((({.....}))))...,{{(((,...,})))},.........((((((((((.(((......))).))))))))))))))...............

Transcripts

ID Sequence Length GC content
CUUUCUUUCUUUCUCUCCUUCUAGCUCUCUUGUCUUUUCUUUGCCUCUG… 5520 nt 0.6556
Summary

The protein encoded by this gene is a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) family. Members of this family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme contains two C-terminal TS motifs and may regulate vascular smooth muscle cell (VSMC) migration. Mutations in this gene may be associated with susceptibility to coronary artery disease. [provided by RefSeq, Feb 2016]

Forensic Context

A study in rhesus macaques identified the ADAMTS7 as a shared downregulated differentially expressed gene in left ventricular tissue between animals with hypertrophic cardiomyopathy and both pediatric and adult human HCM cases [Rivas et al. DOI:10.1038/s41598-024-82770-4].