Basic Information

Symbol
CLPP
RNA class
mRNA
Alias
Caseinolytic Mitochondrial Matrix Peptidase Proteolytic Subunit ATP-Dependent Clp Protease Proteolytic Subunit, Mitochondrial Endopeptidase Clp EC 3.4.21.92 ClpP (Caseinolytic Protease, ATP-Dependent, Proteolytic Subunit, E. Coli) Homolog ClpP Caseinolytic Peptidase, ATP-Dependent, Proteolytic Subunit Homolog (E. Coli) ClpP Caseinolytic Protease, ATP-Dependent, Proteolytic Subunit Homolog (E. Coli) ClpP Caseinolytic Peptidase, ATP-Dependent, Proteolytic Subunit Homolog ClpP Caseinolytic Protease, ATP-Dependent, Proteolytic Subunit Homolog Putative ATP-Dependent Clp Protease Proteolytic Subunit, Mitochondrial ATP-Dependent Protease ClpAP (E. Coli), Proteolytic Subunit, Human ClpP Caseinolytic Peptidase ATP-Dependent, Proteolytic Subunit ATP-Dependent Protease ClpAP, Proteolytic Subunit, Human DFNB81 PRLTS3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_006012.4
Sequence length
2410.0 nt
GC content
0.5568

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-920.60 kcal/mol
Thermodynamic ensemble
Free energy: -964.61 kcal/mol
Frequency: 0.0000
Diversity: 607.09
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((((((((((.(((...))).)))((((..(((......))).))))(((((...(((.((((((((((((((.(((((.((((((((((..(((.((((((...)))))).)))..........((((((.((((((((....(((...)))....))))..)))))))).))))))))))))...))).)).))))))))))))))))).)))))....))))))))))...((((.((((.....))))((((((((.....(((((((...))))))).(((((...))))))))))))))))).((((((((((((((..(((((((..((((.((((((((((..((((.......(((((((....((.((((((((((((...(((((.......))))))))))).....((((.(((((((...((((.(((.((((((...(((........))))))))..).))))))))))))))))))....))))))))..))).))))(((...))).((((((((.((..((....(((...((..((((((.(((....(((((...(((((((((((.(((.(((((.(((.((((....((((.....))))(((.((..((((..(((((.(.(((.(((((...........................)))))((.((((((........)))).)).)).......))).).)))))..))))..((((((((.((((((((.....((((.(((((((.(.((.((((((......)).)))).)).(((..(((((.(((((.......))))...).)))))..)))).)))))))))))((((((..(....)..))))))((((((((((((........))))))))....)))).)))))))).))....)))))))).))).....)))).))).))))).).)).)))))))))))...............(((((((((..........))))))))).((.(((((((...(((((......)))))...)).))))).))(((((.(((((..(((((((.....((((((......).)))))....((((((...))))))..(((((((((..((((((.......)).)))))))....(((((..((((..((((((((((.(((((((((......(((((.((((.(((((....)))))))))........(((((((..((.(.(((..((..(((.(((...((((((...............(((((((....(((((((((..(((((((..((((((....)))))).......))))))).((((((.((((((((...........))))))))..))))))((((.....)))).........................(((((((((.((((((((((((.(..((((.(((..(.((((((.....)))))).).))).)))))))).)))))))).).)))...))))))...((((((((.((((((((((((((((...)))))))((((.((((((.....................(((((((((..............)))))))))..)))))).)))).....((((..(.((((((((....((((..((......))..)))).......)))))))).)....))))))))))))))))))))).)))))))))...)).))))).....))))))..))).)))..)))))))).)))))))(((((.(((((.(((...((((....((.....))..........(((........))).(((((((((((.((((..(((((........).))))..)))).))))...))))))).)))).)))))))))))))......(((......)))(((((............)))))((((((.......)))))).....)))))...(((....))))))))))))..)).)))))))))))))))))))))))......((((..........)))))))).)))..))).)))))))(((((.....)))))....((((((((...((((.(((.....((.((.((.((....))...)).)).)).....))))))))))))))))))))...(((((((......(((((((.....(((..(((..........))).)))...)))))))))))))).))).))))))..))..)))...))..)).)))))))).))))..))))))))....)))))).......(((((((((..(........)..))))))))).....))))))).......)))))...))))))))).
Thermodynamic Ensemble Prediction
...{((((((({,{((.{((|,{|||,}}|(((({((({...,.,}|||}|||({{,,...{{{.((((((((((((((.(((((.((((((((({.,((((.((((((..(((,,(((((((.({....}).).)))))|{((....))||,...,,,.....)))..)))))))).))))))))))))...)))},).))))))))))))))}}}.}})))....})))))))))..,|(((,{({(.,..,)))||||(((((,,{{,(((({((,,.}}}}}||.(((({...}))))}))}}}))))))..((((((((({(({..,|||,||}}}|||}..((((((((..((((,,.....(((((((....(.{((((({{(((((...(((((.......))})))))))),|...(({(((((((((...((((.(((.{(((((...(((........))))))))..}.))))))))))))))))))...,)))))))}..)))},)))|{{...})).((((((((.((..((....(({...{,,{((((({.{({.,.{(((((,..(((((((((((.(((.(((((.(((.((((....((((.....))))(((.((.,((((..(((((.,.,(({(((((...........,,...},.........})}),|))}.{(({..,..,{{|,,|.}},}}.,})}},))).}.)))))..)))),.((((((((.((((((((.....(((,{(((((((.(.((,({((({..,,,.)),)})).},.(((..(((((.(((((.......))))...}.)))))..))),.))))))))))){(((((..(....)..)))))|((((((((((((.,....,.))))))))...,))))})))))))).),...,)))))))).))).....}))).))).))))).).)).)))))))))))............,,.(((((((((..........))))))))),((.(((((((...(((((......)))))...)),,)))).))|(({(.({(((,.{((((((({{{{((((((((.{(.{{|((.,,,,..{{|||,..)))}|||{{({((((((((({((((,.{,,,..,.}}|,..{{{{.{(((((((((.((,..((((((.{({{,,((((((((.(((((({((,(((((((....)))))}((({{(({...,,,(((....))).....}}}}})))..(({{,....})))}............(((((((....(((((((((..(((((((..((((({....}))))).......))))))).((((((.((((((((...........))))))))..))))))({{,.....}}}}..{,,,...........,}}}..|.(((((((((.((((((((((((.(..{(((.{((..{.((((({.....}))))).}.))).)))),))).)))))))).).))}..})))))),..((((((((.((((((((((((((((...)))))))((((.{{{{{,................,.,..(((((((((..............)))))))))..)))))).)))).....((((..(.((((((((....,{{(,,{(,,,...}}.,))))},.....)))))))).)....))))))))))))))))))))).)))))))))...))}}})))...,},)))),.))))).)))),})))..})),)))))|,,,.}},,)))))))))}})).....}}}}..,}.,}}})))))||,,.......}}),,||||,|||||}||{(,,{{(((,{{..{,.|,||,|{{||||.||,....,,,,))))))))})))),,))))))|......}|{,|,||||}}(((({............)))))((((((.......))))))....||,,|,((((((........)))))).}.}}..},})))))))}}},,},)))})}......{({{...,,.,.,{||}}}})).))}..})}.}|)))),(((((.....)))))....{{((((((,..,(((.(((.....((.{(.((.{{.,,.)}...)).)).)).....))))})))))})))))))))}.,(((((((......(((((((.....(((..(((.......,..))).)))...)))))))))))))),))).})))),,)))..)))...))..)).)))))))).))))..))))))))....,|||||,,,,,..(({{{{{{{.,|},,,,,,,|,,}}}}}}})),,,..}}}}}}}.......})))),}}))))))})},

Transcripts

ID Sequence Length GC content
GUAGUUCCGCCAUCGGACGGAAGCCGACCGGGGCGUGCGGAGGGAUGUG… 2410 nt 0.5568
Summary

The protein encoded by this gene belongs to the peptidase family S14 and hydrolyzes proteins into small peptides in the presence of ATP and magnesium. The protein is transported into mitochondrial matrix and is associated with the inner mitochondrial membrane. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the CLPP gene expression was significantly down-regulated in the subcutaneous adipose tissue of heavier co-twins within BMI-discordant monozygotic twin pairs, where this down-regulation was part of a broader suppression of mitochondrial unfolded protein response (UPRmt) genes associated with acquired obesity and metabolic dysfunction [Jukarainen et al. DOI:10.1210/jc.2015-3095].