Basic Information

Symbol
CLU
RNA class
mRNA
Alias
Clusterin TRPM-2 SGP-2 KUB1 Testosterone-Repressed Prostate Message 2 Sulfated Glycoprotein 2 Apolipoprotein J SP-40 CLU1 CLU2 APOJ CLI Complement-Associated Protein SP-40,40 Complement Cytolysis Inhibitor Complement Lysis Inhibitor Ku70-Binding Protein 1 NA1/NA2 Clusterin (Complement Lysis Inhibitor, SP-40,40, Sulfated Glycoprotein 2, Testosterone-Repressed Prostate Message 2, Apolipoprotein J) Epididymis Secretory Sperm Binding Protein Aging-Associated Gene 4 Protein Aging-Associated Protein 4 APO-J TRPM2 Apo-J AAG4 SGP2
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Sudden death from CNS diseases Drug abuse diagnoses

MANE select

Transcript ID
NM_001831.4
Sequence length
2749.0 nt
GC content
0.4998

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-877.60 kcal/mol
Thermodynamic ensemble
Free energy: -928.47 kcal/mol
Frequency: 0.0000
Diversity: 776.84
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.(((.(((........))))))..))((((((((((.((((((....(((((.....(((((....))))))))))..(((...((((..(((((.((((((..((((((..((((((((((.((((((..((((((((((((....))))(((.....))).))))))))..)))))).)).........((((((((...................(((....)))(((((..((((......((.(((.((((......(((((((((((((((((...(((((((....(((((((((((.(((((.((.(((((((((((((......(((((.....((((.((((..(..(((((((((((((((((((((....(..(((.((.((((((((((.....((.(((.....)))))....))))(((((((((...((((.(((.(((((((((((((((((((((((.((((.....)))))))))))((((((........))))))......)))))))))((((..(((...)))))))......(((((((.......))))))))))))))...)))))))..))))))))).....((((((...((.(((((((.....((.(((((((((((((((.((((((((((((((((((((..(((.......................((((.((.....))))))..................(((((.((((((((.(((......)))(((((((...(((.(((.....((((...........))))..((....(((((.(......).)))))....)).(((.(((((........))))).))).(((............))).......))).)))))))))).))))))).).))))).((((.(((.....))).))))..)))..))))).)))).)).)))))))))............((((((((...((((..(((((....)))))..))))...))))).)))...((....))((.((((((..(.((...(((.(((((((....)).))))).))).)).)..)))))).))...))))......))))))).))))......)).....))))))))).))))))...((((....(((((...((((.(((((......))).))..)).))...))))).....)))))))))).)).)))..)....))))))))))....))).)))))))))..)))).))))..)))))((..(((((((((((((.((((...((((((((((((((((((((...(((((((.(((..........))).))))))).(.(((((((.....(((((((.......((.....))...(((.(((((..(((..(((((((((....)))((....)).))))))..)))..))))).)))........)))))))....(((((....))))).((........)).....((((..........)))).....))))))))..(((((((((((..((((........))))..........(((((.(((((((.((((..((...((((...(((.((((((......((((((((.(((.((((.....))))..))).)))......)))))....))))))))).....))))...))...)))).))))))).))))))).))))))).))....................(((....))).......))))))))))))))...))))))((((((.((((((..........((.((((((.......((((((..(((..((((.....))))(((((.....)))))..)))..)))....)))........)))))).))..........)))))).))))))...(((((((((..((((..(((((((((((...........(((....))).((((((...(.(((..((......))..))).)....))))))))))))........((((....(((((((((.....)))))))))..)))).)))))..)...)))..))))))))).(((((((((....)))))))))((((((((.......)))))))).))))..)))))).)))))))..))......)))))))))))))..))((((((.....)).))))(((((((((((((((...)))))........))))))...))))))))).)))))))..)))).......))))))).(((((.......))))).....((((.(((((......))))))))).......)))))...))....))))))))))........)))).))).))...)))).))))).))))))))(((.((((..........))))..))).))))))))..))))))...)))))).........))))).))))...)))......(((((...(((..((((((((((((((((...........((((((((((.(((......))).)))))..))))).)))))).)))))))......)))..))).)))))((((((..((((((.....))))))...))))))...)))))).)))))).......((((.(((((((....))).))))))))..(((.(((....))).)))))))...........
Thermodynamic Ensemble Prediction
((,(((,(.({....}).))))))(((,({(((((((((((......)))).))}....(((((....)))))(((((((.((((.((((..(((((,((((((((((((((..((((((((,,.((((((..((((((((((((....))))(((.....))).))))))))..)))))}.||,,|,..{{.{(((((((.....,,....,|......(((....}}}(((({..((((......{(.(((.((({......{((((((((((({......})){{{({....{{{{{((((((.(((({.{{.{((((((((((((......{{(({,,,..((((.({({..({{(((((((((((((((((((((....(,,{((.((.(((((((((,((((((((....{,..,({(((((...,.(((((((((.{{(({{.(((.(((((((((((((((((((((({,((((.....)))))))))))((((((.,,...,,))))))......))))))))|(({(..{((,,.,,.)))),....,{((((((.......))))))))))))))...)))})))}.))))))))).,...))))),.)},((((.,......,.)))).))))))))})),.{(({{|{(({|({((({||((({({,,,,,,......,.{(((||(((((|,(((.(({..(((((.....,,,,,|||,......}|{{{({.,,,.,(((((((({....(((((..((((({.{(((((,|({,,......,.{,{||||,|{{,,{{,,{({.,((((.....{{(((,..{,.(((.(((((........))))).))).)))))}...||....)),....,...||}}.}}})}}))}}..,,,,..,(({,{{{(,({((({...,)))|)}}}..}}},.))))).}.)))))).))))),...,,,,..,....((((((((...((((..(((((....)))))..))))...))))).)))}))))))))))||}((((((..(.{{...(((.(((((((....)),,)))).))).}}.)..)))))).|,....{{{.....,.)))|||,||......,.,))}}}..}.))).))))))))).).)))),,...|))))||)))|)),|}},.,,}}}..,|,..}),),.},}||||......}}})))))),)).))),,},|..))))))))))....))).))))))))}}}}))),}}))..))}))|{},|||(((({{(((({,{{{,{.((((((((((((((((((((...(((((((.({{..........}},.))))))).(,(((((((...{.(((((((.....,.((.....))...(((.(((((..(((.,(((((((((....)),{{...,)}|)))))),.)))..))))).))}........))))))),,..(((((....))))).,|,,,.....,,....,(((,...}}},...))}}.,,..))))}))}.,((((((((({{..,(({,,,,,{,.||,,......,,..{{{({,(((((((,(((,..,{..,(((,...{{{.|||{{{..,,{,,{{{{{{{.{({,||((||...}})).,)})}))),....,}}},}},,,)))))||||,,,,,}||}...,,...},,),)}}))))}))))))).))))))).))........,....,|.....{{{.,..)))....,,.))))))))))))))...)))))).,......,}}}|,},,.....{((((((.,(((......))),)))).))}{{{{,,.,,)}}}(({{{,....)}))),.|,|,,(((((,,((......(((((.(((((((({{,,,{{(((......|||||||.(((((((((..((({..((((((((((({({{,.,....(((....))).((((((.....{{,..{{......))..),}})}}..}}))))))))))........((((....(((((((((,...,)))))))))..)))).)))))..,...)))..)))))))))..||||||||....))))))))))))))..)))))......))))))))....|||||..,}}))))}.}}......)))))))))))))..}}{|{|{|,....)),)))){{|{{{{{{{(((({...))))).....,,,))))))...))))})))).)))))}),,)))).......}})))(({(((((.......))))},))).(((,{(((((......)))))))))...,,.{||,,....)),.,,))))))))))..,,....)))).))).))..,)))).))))).)))))))}||,.|{||.......,,,}})),}})).))))))))..)))))}.,))))})),........})))).}))}....)))}..)))).)))}))}}))}}|{(((((((((({{......,...{{,{({(((((.(((......))).))))).,}},)).,))))),))))))}...,,,}}}..,{{.((((((((,........(((((((.(({..(((.((((((({.,{({.((((....))))..,}}})))))))).)))})).))))))}{{{{{......}}}}))))))))),,,.........

Transcripts

ID Sequence Length GC content
GCGGCGUCGCCAGGAGGAGCGCGCGGGCACAGGGUGCCGCUGACCGAGG… 2749 nt 0.4998
Summary

The protein encoded by this gene is a secreted chaperone that can under some stress conditions also be found in the cell cytosol. It has been suggested to be involved in several basic biological events such as cell death, tumor progression, and neurodegenerative disorders. Alternate splicing results in both coding and non-coding variants.[provided by RefSeq, May 2011]

Forensic Context

A study in humans demonstrated that the CLU is significantly upregulated in peripheral blood mononuclear cells of patients with heart failure post-acute myocardial infarction compared to non-heart failure controls [Wei et al. DOI:10.3389/fcvm.2025.1611668]. A study in mice demonstrated that the CLU was upregulated in microglia at 14 and 60 days post-traumatic brain injury, showing a stable expression pattern at 2 days post-injury before increasing [Izzy et al. DOI:10.3389/fncel.2019.00307]. In equine doping control research, the CLU was identified as a protein significantly increased during administration of a testosterone ester, and a targeted multiple reaction monitoring assay was developed for its detection [Reichel DOI:10.1016/J.Forsciint.2011.07.031].