| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAUUUGCUCAGGCAGCCUCUCUGGGAAGAUGCUGCUUCUUCCUCUCC… | 786 nt | 0.5254 | |
| AGCAUUUGCUCAGGCAGCCUCUCUGGGAAGAUGCUGCUUCUUCCUCUCC… | 937 nt | 0.5229 |
This gene encodes a chymotryptic serine proteinase that belongs to the peptidase family S1. It is expressed in mast cells and is thought to function in the degradation of the extracellular matrix, the regulation of submucosal gland secretion, and the generation of vasoactive peptides. In the heart and blood vessels, this protein, rather than angiotensin converting enzyme, is largely responsible for converting angiotensin I to the vasoactive peptide angiotensin II. Alternative splicing results in multiple variants. [provided by RefSeq, Apr 2015]
A study in human dermal injuries demonstrated that the CMA1 (CMA1) mRNA expression was reproducibly detected but strictly limited to the 0–2 minute post-injury time point, showing a time-restricted pattern useful for forensic injury age estimation when used in combination with other markers [Palagummi et al. DOI:10.1007/S00414-013-0941-5]. A systematic review of human skin wounds from forensic autopsies identified the CMA1 as a proteomic marker of mast cells, with its density being higher in vital lesions compared to post-mortem wounds, indicating its application for vitality differentiation [Ros et al. DOI:10.3389/fmed.2021.786798].