Basic Information

Symbol
CNMD
RNA class
mRNA
Alias
Chondromodulin BRICD3 MYETS1 CHM-I LECT1 CHM1 Multiple Myeloma Tumor Suppressor 1 Leukocyte Cell Derived Chemotaxin 1 Leukocyte Cell-Derived Chemotaxin 1 BRICHOS Domain Containing 3 Chondromodulin-1 Chondromodulin-I CHMI
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_007015.3
Sequence length
1455.0 nt
GC content
0.4742

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-442.90 kcal/mol
Thermodynamic ensemble
Free energy: -471.93 kcal/mol
Frequency: 0.0000
Diversity: 367.68
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((.(((((((.....))))))).(((((....)))))......((.((((((...(((....((((.((....)).))))...)))...))))))))...)))))))((((((.((.........((((.((.((.(((((((.....))))))).))..))...))))(((((((((.....(((((((...)))))))..((((((((((((((((((((...((((.(..(((((((.(((((.(.((((......)))).))).))).)))).))).).))))..))))))......(((((((.((((((((..(.(((((((((......((((((((.((((..(((............)))...)))))).))))))..............(((((..(((..((((((((((((((((.(..(((((((((((....((((..(((((.((((....((......)))))).)))))))))(((((((((...(((((.......)))))..((.(.(((.(.((((.....)))).).))).).))...........)))))))))..((...((((..((((..((((.(((.(((.((.((....)))).))).))).))))....)))).))))....)).......)))))))(((((((((....)))))))))..))))..)))))))))))).(((......)))...............((((((((((...(((.....(((.(........(((((((.....((((..............)))).....)))))))(((.((((((((....(((...........)))..))))))))...((((.((....))))))...(((((.................))))).)))...).)))....)))..))))...))))))...)))))..))))))))...)))))).))))..)))...))).)).))))))).............))))))))).)))))...((((((.........))))))(((....))))))))))))((((..((((......)))).))))(((((.....)))))...(((((((.....))))))).((((((..(((......((((.((((((((((.((((.(((.((((..(((.((((((((((.(.((.(((((...........)))))))))))))))(((..((((....)))).)))......(((....)))....((((....))))((((((((((....))))))))))((((((((.(((((..((((((.((................)).))))))..))))).))))))))))).)))..))))..))).)))).)))))...)))))))))...))).)))))).......))))))))......
Thermodynamic Ensemble Prediction
.(((((({.(((((((,,..,}}|||}|.(((((....))))),}}},,|,,|(((((.,|(({,.,,((((.((....)).)))),))))}...})))}),}..,}||||||(({{((,((.....,..,({{{.,,.{(.(((((((.....})))))).}},,||,,.}}},,{(((((((,{...(((((((...)))))))..((((((((((((((((((((.((((((.(({,...|})}))))}}({{((,{{....|||(((.,,,,.})}})}},,}))))))..)))))}......(((((((.{(((((((..(.((((((((((((((,(((((({{.((((..{({............}})...))))}}.)))))}....,.,,{{({{..,..{{{((((.(({{,{((((((((((.(..(((((((((((....((((..(((((.((((.,..,,....,.,,)))).)))))})))(((((((((...(((((.......)))))..,{...{(({(.,,,,.....}|}}.},))}.|.,,....,..,}).)))))))))..{{...((((..((((,,((((.(((.(((.({{((....)))).))).))).)))).,,.)))).)))),{..,,....,..)))))))(((((((((....)))))))))..))))..)))))))))))).{||,,,...}}}.,{,.{{,....,..,(((,,,,||,..{,,.....{{|||........,((((((.....((((..............)))).....)))))),,||.|{((((((....(((...........))).,)))))))}...||||.||,.,,))||||{..,,{((((..,..,,,,.},},,,||}}||||,....,,,....})}..))))...))))}}...,}})),.,}}))))),..}))))).))))..)))...))).)}.)))))))......,.....,))))))))).)))))...((((((.........)))))){{{....))})))))))))||||,,|{||},,.,,,))))))})|((({.....))))){{{(((((({.....}))))}}.{||||{.,{{(,,,...{(({.((((((((((.((((.(((.((((..(((.((((((,((((((.(((((((..{{{{{.,,......,.{{{|...}|||.{((((..{{||||{|{|{,....(((....)))....({{{....}))},(((((((((....))))))))))|||||.||,||||...,,..,|,,|,,},,.........}}))}..,.))))))).))))))})))))).)))..))))..))).)))).)))))...)))))})))....,..}}})}}....,,,}})))))),.....

Transcripts

ID Sequence Length GC content
AGGCGGGACCGUGCACCGUGUGUGCGCGCGGCGUUGAAAUGCCCUGCAC… 1452 nt 0.4738
AGGCGGGACCGUGCACCGUGUGUGCGCGCGGCGUUGAAAUGCCCUGCAC… 1455 nt 0.4742
Summary

This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that chondromodulin 1 (ChM1) mRNA levels in adipose-derived stem cells (ASCs) differentiated into a chondrogenic lineage were not significantly different between animals subjected to a 60% total body surface area scald burn and non-burned controls, indicating the chondrogenic differentiation potential and stability of this marker in ASCs is preserved following severe burn injury [Prasai et al. DOI:10.007/s12015-017-9721-9].