| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCGGGACCGUGCACCGUGUGUGCGCGCGGCGUUGAAAUGCCCUGCAC… | 1452 nt | 0.4738 | |
| AGGCGGGACCGUGCACCGUGUGUGCGCGCGGCGUUGAAAUGCCCUGCAC… | 1455 nt | 0.4742 |
This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that chondromodulin 1 (ChM1) mRNA levels in adipose-derived stem cells (ASCs) differentiated into a chondrogenic lineage were not significantly different between animals subjected to a 60% total body surface area scald burn and non-burned controls, indicating the chondrogenic differentiation potential and stability of this marker in ASCs is preserved following severe burn injury [Prasai et al. DOI:10.007/s12015-017-9721-9].