Basic Information

Symbol
COL1A1
RNA class
mRNA
Alias
Collagen Type I Alpha 1 Chain OI4 Collagen, Type I, Alpha 1 Collagen Alpha-1(I) Chain Alpha-1 Type I Collagen Collagen Of Skin, Tendon And Bone, Alpha-1 Chain Collagen Alpha-1(I) Chain Preproprotein Type I Procollagen Alpha 1 Chain Collagen Alpha 1 Chain Type I Pro-Alpha-1 Collagen Type 1 Collagen Col1-ColIII-1 Collagen Col1-ColIII-2 Alpha1(I) Procollagen Type I Proalpha 1 EDSARTH1 CAFYD EDSC OI1 OI2 OI3
Location (GRCh38)
17:50184101-50201634
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Other applications
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000088.4
Sequence length
5914.0 nt
GC content
0.6155

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2402.00 kcal/mol
Thermodynamic ensemble
Free energy: -2496.70 kcal/mol
Frequency: 0.0000
Diversity: 1910.62
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((.((((((.(..((((((((((..((((((..(.(((((..(((((..(((....)))..(((...((((.(((....((((((((.....((((((((((...))))))))))....))))))))(((((.(((((((((((((((((((((((...((((((..(((....((((........))))..)))))))))................(((((((((((.((((((.....((.(((.(((.((((.((......))))))..))).))).))...((((((.((((((((.((((((......)))))))))..)))))))))))..................(((((((((((..(((...(.(((.((.(.(((..(((((......)))))..)))).)).))).).)))...........)))))))).)))((((..(((.(((.((((((..((.(((((..(((((((.((..((((...((((...(((((((((...(((.((((.(((......(((((..(.((((((((.(((((..(((((((..((((((((((((.((...)).))))((((((((((...(((..((((.....))))((((((((....((((((........))))))..))))))))(((((.(((..(((((((((....(((.(((.(((...)))(((((((((.((....))))).)))))).((..(((.(((...((((((.(((.(..((((((..((((((((((....))))).......)).)))..))))))..))))...))))))...))).)))..))))).)))....)))))..)))).))))))))...))).)).))))))))..(((((.......)))))....)))))..))).)))))))..))).))..))).......))))).)..)))))..((((.(.((((((((((.(((((........(((....((((((..((((.((.(((((((..((....))..)))))))...)).))))))))))..)))(((((((((....))))..)))))))))).)))))))))))))))((....((((((...))))))))))).)))))))..)))))))))...)))).))))...)).)))))))..))))).)).))))....)))))))).)))))))))))))).(((.((((.((((((((..((.......)).))))((((((...(((((((.(((...(((..(((.(((((((..((((((...))))))..)))))))(((((.((.(((((..(((..((.(((...))).))...)))..))))))).))))))))..))).))).)).)))))..))))))...(((.(((((((((........))))).)))))))....)))).).))).)))...)))))))....(((....)))))))..))).)))))))......)).))))))).)))))....((((..(((((.((.((((.((....)).)))).))..)))))..))))..((((.((....))))))(((..((((.....((((((((.((((((....((.((((((.(((((((.((((.(((((((((((.((.((((...(((..((..((..((((((.....(((((((((((.(((((((.(((((((...((...((..(((.(((...(((.(((((((...(((((.....)))))...))).)))).)))))).)))..))...)))))))))...)))))))...)).)))))))))....)))))).))))..)))...)))).))..))).).).)))))).))))))))))).)..)))))))))))))..)))...(((((((.....((((((((((((((((((.(((.(.(((((.((....)))))))..).))).))).....((((((((((..((((((((((((.....))))....)))))))).(((((.((....))....))))).((((((((((..((((((((.((((((.(((..((.(((((((((((((((.((((((((...((.....))...))))).......))).)).).))))).))))))).))((((((.(((((((((.....((((((.((.((.((...(((..(.((((.....((((((((((((...((((((((.........(((((((...)))))))))))))))...((((((((.(((((((((((..(((((..(((((((..((((.(((..(((.((.((((((.((...)).)))...))))).)))(((((((..((((.(((.((...((((((((((((.((((.(((.(((((....)).)))...(((..((.((((...(((((..((((((....))))))..)))))...)))).))..)))...))))))))))).).))).)))).)).)))...))))..)))))))(((..((((...((...((((..(((.((((((...)))..))).)))...))))..))...))).)..))).))).)))))))))))..))))).((((((.....(((((.((((((((..(((((.((.(((((.((((....((((((....((((((((.....))))))))(((((..(((.((((..((((((((.((..(((((..(...((.....))....)..)))))..))))))(((((((.(((((((.(......).))))..))).))....)).))).((.(((..((((((((((((..((...((((.((....(((((..((.(((.....))).))...)))))....))((((((((((((.((.(((((((((((.....)))))......)))))))).)))).(((.(((((((.(((..((((.((((((((.((..((.((((((.....)))))).))..)).)))))....))).)))).....(((((((((((.((.((.((.((((.(((....))((((.(((.(((((((((((((((.(((((.....))))).)))))))......)))))))).))).)))).).))))))))...((.((..((((((.....((((.(((.((((.(((.(.(((((((......(((((....((.((.((.((....)).)).)).)).((((.....(((((((..(((.((((((((((((.(((((.(((((((...))))))).)))).(((((((((.(((((((.((((((((.(((.((..((.((....))))..)).))).))..)))).......)).))))))))))))).)))....).))))))))......)))).)))..))))))).....)))).....((((((...((.((......))))...))))))...))))).))))))))))).))))))).))))(((((((((((((..(((..((..(((((....)))))..)).))).....(((((....)))))((((((((((((((((...))))))(((((((((..(..((((((....(((((....)))))..((((.....)))).(((((........)))))...........((((((((..(((....)))..)).))))))..........))))))..)..))))))).))...))))))))))....(((((((...))).))))..))))....)))))))))..)))))).))))..))))))))))..))).........))).))))))))))................(((((.(((...((..((((((.(.(((((((.......))).(((.((......)))))((((..(((.(((((((........)))))))..))).....)))))))))))))))..))))).)))))((((.....))))..))))))))......))))...))..))).)))))))))..))).))))))..))))..)))..))))).))))))))))..))))))).)))))..)))))))).)))))))))))........)))))))..)))).)))).))))...))))..))))))))))))))))..)).)).))))))))....))))))))))))))).........))).)))))).)).....((((.((((((...(((((..(((((.((((((((...((((((........))))((((((((....(((.((.(..((......))..))).)))..))))))))...........................)).)))))....))).)))))....))))).)))))).))))...)))))).....((((........)))).)))))))))).((((((.....(((((((((...(((((..................(((((.........)))))..................(((......)))..))))).....)))))............))))....((((((.....))))))))))))))))))))))........)))))))))))).))))))).))).)))))...))))....)))............(((((((((((((((((((((((.((((((((((((((...((((((((((((.((((.....((.((......)).))(((((((..((..((((((..(((((((.((....)).)))))))..((((.......(((((((.((((.((((((..((((((.(...(((((((.((((....(((.(((....))))))....)))).....(((((((((.............))))))))).....(((....)))(((((((.((((.((((.(((((((((((((.((..((((((((((...))).)))))))........((((....(..(((((.....(((((.((((..((((((((.(..(((..((((((((....))))))))..)))..).))))))))(((((((......))))).)).)))).)))))..)))))..)......)))).......((....(((((((....))...)))))....)))).)))).))))))))).(((......)))............(((..((...(((((............)))))...))..)))(.((((....)))).))))))))).))))))).))))))).).))))))...........((.(((((...))))).))....))).))))))))))))))......)).))..))))))..))..)))))))...))))))).....)))))))))....))))).))))............)))))))))))))))))))))))))))).))).))))....)))...........(((((..........(((((((.(((((.(((.((((.......)))))))))))).))))))).........))))))))))..))))).)..))))))...))))))))))....(((((((((((......((((.(((((..((..((...((......)).))..))..)))))....))))....)))))))))))....(((((((..((.....)).......((((...))))))))))).............(((((.(((.....))).))))).....((((((((........)))))))).((((.......)))).).))))))..)))...
Thermodynamic Ensemble Prediction
,{,{{((((,(,..,|||{||{(((((({(((((((({..(((({({{,(,(({|,|{|..{{(,((..,,....}}.}}}.....((((((((.....((((((((((...))))))))))....)))))))).||||.||||||||||||,,,{||{{{||.}}||||||,,|,|...,||||..}}}},.||||..||},|||||{{.{{.(({......{(((...(((((.(((,,((((..((((((.((({(((,.{{,,...,},}}||,,,||.|||{{{.{{((((((.(((((,(({((((((......)))))))))..))))))))))).{{{(.{((,.,{.{(((((((((.({....},..))).)))).|}},|||||,||||.{{.,.{,.((((((...(((((...((((({.{......(((((.,,((((((((((.((({({({({((((.((((((((..{((((..,,,(((((,..|,,|(((,...,))}...,..||...})),)|.....({((.....||||.....||||.....))))..))))))))))))).||,.......,||,}}}).}}|}}}..{{{{,,(((,....}})}..{{{{|....))))).}},,)})))).)))))))))).,,{((((((.((((((.(((....(((((.((.((.(((,{((,{((((((({,((....))))).)))))))).).))).)).)).)))))..))}.({{.((....)).))}(((((....))))).......)))))).))))))).)))))....,}))))))....)))))...))))))|}..{{((((({((({.(({(.((...((({(({.({{(({{,,(((((.......)))))..|||{{|,,||{((((.{{((.{((.((({.((({...{(,{{,{,.|,.||}}}..{(((.(.((((((((((,({(((,......,(((.{{.((((((..((((.((.(((((((..((....))..)))))))...)).))))))))))..}},||{|||{((....,},}.,)})))))))).)))))))))))))))))}.}}))))),.}}))))).))))},|||||((((((((({...}))))),.))).,,)))))|}))....)))))}})})))))}}.,))}))(((((({..(({.(({.(((..((({,,,,.||{,..||}}}.))}))).))),))).,...}}))))).||,|},|||}}||||((((((,..||||||,..||}}}}},})))}},}},)).)))),.)),}))),))))))).)))))),.}}}|(((({.,(((,.{|||{|||{{,.{{|},||,.||||.,{|,||||{..((({,(,((((((.{{,,{,.|||,,.,,))}})}}}.{{({.{.,||{||{{{....)),)},,.|||..}})))}}}|{{,||.,,,})}..}}...)).)))))).},))))..,,({((..(((((,((.((((.((....)).)))).)).,))))).,)})),.})))},))}.))))))|,}}}..}}.}}}}}}}|.}}}..}})}}|})}.}}}}}..))))}})}).}))}}}||||}|||,,..{((..,,||}(((({{((,(((.({{{{((((,,(({((({((({{((((({,,((({(({.{{((..|||||||}|||},|((((({(,,(((...,{{(({{...,,|||...}}}||||,.,..{{{{,....,)))).{{(((,,,,||||}{((..(((((.(((.((((((..((((({{(((((((({...,|||{{((((((.,.,,}}}}}}.{(((((,{{((.{(({{{||(|||,|{(({(((((((((((,,,,(((({{,,..,.,(((,.(((,((,((,(((((,..||||||}}}.,||{{}},.{{{(((.,{{{.(((.......))))))))})),...}}||,..||||||..}))))))}}),.}}||||}||||{{},.}}}}||{,..((((,....)))),,}}}}},||||||||{{(((((.,({(((((((.{{{,(,.,{{||.{{.|,||...,|((,({{,((,..|}.}|}.})}.|}}}}},).))),,||,|||,.}}))))))).,}))))},))))}}.)))))))))),.))).|.,|||||.|}||}|||.})}})}))),{((((((...)))))))..))))))))}||||{|{{.{{({((({(((,.(((((..(((((((..{(((.(((..(((.((.(((((({({...)).)))...))))).)))(((((((..((((.(((.((...(((((((((((,{((({{(((.(((((.,,.}}.|||,..({{..||.|||{...(((((..((((({....})))))..)))))...)))),)),.)))...))))))))))).).))).)))).}),)))...))))..))))))){((,.{{{({{,((...((((..(((.((((((...)))..))).)))...)))),,)),..})).}..})).))).)))))))))))..))))).||||{|,,...(((((.((((((((..(((((.((.(((((.((({...,((((((....((((((((.....))))))))(((((..(((.((((,,({((,(((((({{(({((,{,,{,{{,,{,{||....{,.|||||..,,||||(,,,.(({((({(({,(..,,..|,}|}||..||.}},||.||.|,|{(({((|..(((((,,{{{||||}|..}||||}}|}},.||{{{..{|.{||,....})).))..,)))))....)),||||{,|||||,(({(((({,((,((,.,,.|,||||{.,..(((|{,|(,{{||.(((.(((((((.(((..((((.((((((((.((..((.((((((.....)))))).))..)).)))))....})).)))).....(((((((((((.((..,,((.{,{{,,{({{{,,,((((.(((.(((((((((((((((.(((((.....))))).)))))))......)))))))).))).)))}.,||..}}}|}|||},..,.,||||||,.,|.((((.(((.((((.(((.(.(((((((...,,.(((((....((.((.((.((....)).)).)),)}.((((.....(((((((..(((.((((((((((((.(((((.(((((((...))))))).)))),((((((((,{(((((((.((((((,(,{({{(({.((.((....))}},,}),))},,),.)))).......)).))))))))))))).)))....,.))))))))......)))).)))..))))))).....)))).....((((((...((.((......))))...))))))...))))).))))))))))).))))})),))))((((((((,{(((..(((..,{..(((({....||}}}..,.(((((....)))))....|||}}{(((((((((,{{(({,..||}||}((.({{(({,....{((({{....(((((....)))))..((((.....)))).(((((........))))).....{,....((((((((..(((....)))..)).)))))).},.......))))}}..,..)))},,},)),..)))))))))),|,.(((((((...)))))})).,}.))).))))))))))).,|,|,.,.}))),.))))))))))..))),.....,,,))).)))))))})).}},.}},..,}..||{{(({.{{,,{{((..((((((.(.(((((((.,{{...,)),|||,((......)))}}{{|{|,(({.(((((((........)))))))}})),..,..}}}})))))))))))..})))),),)))||{|.,,.,))))..))))))))...,}}))}})),),.}))).,,}})))))}}))).))))))..))))..)))..))))).))))))))))..))))))).)))))..)))))))).)))))))))))........}}))))),.}})),))}},}))}.}))))..)))))))))))))).))}....}}},}}})))}....))))))))})))))))...|{,.....||||{{|,,...,))))))),,...|}).,}.,,,}}}}))))}.)))),...)))))))))))..((({(((,.,(((|||{(({..,..))}}.,.||||,,,|||||||..}.}}|||.|{,....,,....||{{{,.|{.{{{.,...(((((((...)))).)))......))}.}))}}))}}}}}}.}},))...}}))),..)}}}}}))))))))}))),,,,.,.........,,{{{,.,....,.(((.((((((((((.......{((((.........))))}..((((.((..((((((((((((((((...,{{{{{,.....(({(({{...,}}}.,,|||,|},,((((((.....))))))...{{,|,,,|||,|||.,,,{.{{{{{{{{.{(((......}))}.}})}..,}}}}}...|||||,,..,,..,,,.,{.,,,,,,,,,,...,,,,{{.............||||},...,|||||||{}||||{,,},,|,.||..},..}),)))))))).......(((((((.(((((((.{{....}}.)))))))..(((((((((((((..((((((..((((.....(((((({({{{(....,{,{,,,....,,((({{,...,),}))}}.,))}......(((((((((.............)))))))))............({(({,,{{,,.....|{|||||,{{||..,(((((..(((((((...)))))))..)))))|....,}}.,,((,,..(.{(({.,(((....)))}||.|..|)))||||,|..(((..((((((((....))))))))..)))..))))))),,,,..))))).....))))..))))))))).)))))))))).........))))))}..}))).))))))....)).))))...,(({{({...))))))(((((.(((((((((((({.(((.,.(({.(......((({.(((((,(((......},,.{{({({((.,{...}}.})))))},..{((((((((((((((((|(((((((,{((|.((((({,(((({{{,,{.,({.(((((...))))).)).}}})))))))|{((((((((..(({..((.|....{{{..{{((((.((|.....{{{|||(((((........))))}|.|||{,.|,....,,.....,}}......,,,,,................|{||{.|||{.{{{..({{...,))..}}){{,........,.{((((((.(((((.(((.((((.......)))))))))))).))))))}.})}}..)})))..|||,..))).}},},)}}}),,)}}}}},}}.,}}}}.))..)))..)))))).)))}})))))((((.........)))}...,,),).))))}))).))))),)}))))))))))})))).}))}.,....}}}.}.))).)))))))))))))))))))))))))))).)))...||||,,({{{{.{{{...,,}}).))))}.....,}||)}}),}}},..,|{{{{{.{{((((.......)))).)),))))))},,,...

Transcripts

ID Sequence Length GC content
NM_000088.4 NCBI
GCAGACGGGAGUUUCUCCUCGGGGUCGGAGCAGGAGGCACGCGGAGUGU… 5914 nt 0.6155
Summary

This gene encodes the pro-alpha1 chains of type I collagen whose triple helix comprises two alpha1 chains and one alpha2 chain. Type I is a fibril-forming collagen found in most connective tissues and is abundant in bone, cornea, dermis and tendon. Mutations in this gene are associated with osteogenesis imperfecta types I-IV, Ehlers-Danlos syndrome type VIIA, Ehlers-Danlos syndrome Classical type, Caffey Disease and idiopathic osteoporosis. Reciprocal translocations between chromosomes 17 and 22, where this gene and the gene for platelet-derived growth factor beta are located, are associated with a particular type of skin tumor called dermatofibrosarcoma protuberans, resulting from unregulated expression of the growth factor. Two transcripts, resulting from the use of alternate polyadenylation signals, have been identified for this gene. [provided by R. Dalgleish, Feb 2008]

Forensic Context

A study in human post-mortem heart tissue demonstrated that high-quality mRNA for the COL1A1 can be extracted from right ventricle samples and its expression levels, quantified via real-time PCR, remain stable and independent of the post-mortem interval in samples with non-degraded RNA [Partemi et al. DOI:10.1016/j.forsciint.2010.07.005]. A study in mice demonstrated that hepatic expression of COL1A1 was dynamically altered in response to long-term high-fat diet and ethanol feeding, showing ethanol concentration-specific up-regulation at 13 weeks and significant down-regulation at 26 and 39 weeks with progressive liver injury [Liang et al. DOI:10.3390/Ijms241914564].