Basic Information

Symbol
ADCY8
RNA class
mRNA
Alias
Adenylate Cyclase 8 AC8 HBAC1 Ca(2+)/Calmodulin-Activated Adenylyl Cyclase Adenylate Cyclase 8 (Brain) Adenylate Cyclase Type VIII ATP Pyrophosphate-Lyase 8 Adenylate Cyclase Type 8 Adenylyl Cyclase 8 EC 4.6.1.1 ADCY3 Epididymis Secretory Sperm Binding Protein Li 172mP Adenylyl Cyclase-8, Brain HEL-S-172mP
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_001115.3
Sequence length
4421.0 nt
GC content
0.5426

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1618.90 kcal/mol
Thermodynamic ensemble
Free energy: -1699.11 kcal/mol
Frequency: 0.0000
Diversity: 1273.55
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((.(((((..((((.((....((((((((((((..........)))).)))..))))).)))))))))))((((((((..((((.(((((((...))))..))))))).(((.(((((.......))))).))).((.(((((((....((.(((((((((.((.((((.(.(.((((((.((((((((.((.(((((.((....(((((..((......))..)))))....))..)))))))))))))))((((((((((((((((..(((...)))..))))))))))...(((((((.(((((((.(((.((........)).))).))).))))(((.((((((((((...((((......))))(((((..(((((((((((((((((...(((((((......((.((((.......(((((((((.....)))))))))....)))).)))))))))....)))))..........(((((((.(((.((.(((((((((((((((((((.(((.(..(((.((((((((((..(((((((((((...........)))))))))))(((((((.((((((((((((((((((...)))))))).((.........)).(((..(((.((((.......)))).)))..)))(((((.((..((((((((....))))))))....)).)))))..))))))..))))....)))))))....((...)))))))))))))))..).)))((((((((....((((..((((((...((((..(((.(((((..............))))).)))..)))))))...)))..))))))))))))((((((((((((((((.(.(((....(((((.((((((((....(((((((((........)))))).))).)))))(((((((((((.(((((((((((...((((.(((.((((.....(((((((((((.......(((......)))...))))))).)))).......((((.......)))).....(((.......((((((((....)))))))).)))......((.((((((((((((.(((...))).))....)))))))))).))...)))).))).(((..((((((..........))))))...)))..(((((((((((..(((((((.(((((((..(..((((...((((((((.......(((........))).((((((.((((((((((((((.((......)))))))))........((((.....)))))).)))))))))))((((((((......))))))))..))))))))...))))..)...)))).)))))))....)))..)))))).).)))).....)))).))))).))).......))).)))))))))))...((((((((((((((((((((.(((......(((((((.(((....))).).))))))....))).)))))))((......))......))))..))))))))))))))))).....(((((....)))))))).)..))))...(((....))).....)))))))))))).......))))))))))))))))))))).))))))...))))))))))))).................))).))))).)))))......))))).))).))))))).)))))).....(((..(.((((.....)))).)..)))(((((((((....(((((((((...((((....))))........((((..((..(((.((((((.((....)).))))))..)))..)).))))...(((...)))......))))))))))))).)))))...((((((...(((((..........)))))....)))).))..(((....))).......)))))).).))))).)).))))))))).))...))))).))...))...((((.((.....(.((((((((...((..(((((.((((.((((...((((..((.(((.(......).)))..))..)))))))))))).(((.(((...))).)))(((((..((((.(((..((((..((((((..(.(((((((((...((((..(((..(((((...(((((...((((((...(((.......)))((((((......))))))......((....(((((.((((((((....)))))..)))...)))))....))(((.(((((((.((((((((((.(((((.((((((((...(((.(((..((.(((......((((((.((((((((....)))))))).(((.(.(((((.(((((((((((((.(.(((((.......(((....(((((((......))))))).....))).))))))))).)))...))))))).))))).).)))....(((....)))))))))......))).))))).)))....))))))).........((((.......)))).(((((...))))).).)))))........(((((((........(((((...((.((((((((((((..((........))..))))..)))))))))).)))))........(((((...)))))......)))))))((((((.((((.((((...........)))).)))).).))))).)))))))))).))))))).)))........))))))(((((((((....(.(((((((..(.((.((..((.(((((.(((((((((....(((...((((((((((((......((((((.(((((................(((((((..(((........)))..)))....)))).((.....))....(((.((((...((((((((((((....((......)).))))))).................((((((((((....))))).)))))...)))))...)))).)))...))))).))))))......(((((((.((....(((((.(.......((((((((((.(((.((((.((.((((.(...(((((....((((((((..............)))))).)).))))).).)))).)).))))..))).))).......((((...(((.(((((((......)))))))...)))...))))......)))))))......)))))).....)).)))))))............((((((...(((((..(((((((((......))))(((((((((((((((((((((((.(((((((((((((((........))))))).)))).))..(((((((..(((((......................)))))....)))))))....(((((((((.(.((((..((((.....)))).........((((((......))))))(((((..((((.....(((((((...)))))))))))..)))))..((((.(((((((((((...................)))))))))).).))))((..(((((.((((.(((....))).)))).))))).))(((((....)))))((((((....)))))).............)))).)...)))))))))....(((((.......)))))...(((....))).....)).))))).....)))))))))))))))).))..((((..((((...((((...(((((.((((.((((....................)))).))))....((((....)))).......(((((..((((((((...)))))).))..))))).)))))...))))))))......)))).(((((....)))...)))))))..)))))...))))))((((....))))(((..((((....))))...))).)))))))))))).)))...))))))..))).))))).)))))).)..))))))).)....))))))))).............((((((...)))))).))))).))))).)))..)))))))))((((.((.((((((..((.(((......))).)))))))).)).)))))))).)..))))))..)))).)))..))))...).))))......))))).)).)))))))).).....))..))))......)))))))).((.((((((......)))))).))(((((((...)))))))...((((....((....))...))))..(((((((.........)))))))......(((((((.(((((....))))).)))))))....((((((((......))))))))))....
Thermodynamic Ensemble Prediction
...,,((({,,(((((((({{((,,{(((,{{{,.{{{{{{,,,{||{{(({..||||,.,({((..({.((((((((,{{{({,,|(|(((((((..,.({,,.|||.{(((((((((((.,...|{|..,||}.{{.{((((((....((.(((((((((.((.((((.(.(.((((((.((((((((.((.(((((.((....(((((,,({.....,))..)))))....))..))))))))))))))){{{{{,((((((((((..(((...)))..)))))))))).{,(((((,,,(((,..(((({,(((({.....}.})))})))),)))(((.((((((((((...((((......))))(((((..{((((((((((((((((...(((((((......{{.((((.....,,(((((((((.....))))))))),...)))),)))))))))....)))))......{{{..({,(((.(((.(,{(((((((((((((((((((.(((,,{{((,{((((((((((..(((((((((((.........).))))))))))),{({{(({((((((((((((((((((...)))))))).({.........,,.(((..(((.((((.......)))).)))..)))(((((.{(,,((((((((....))))))))...,)).)))))..))))))..)))).}},||}}}},....||,,.,,))))))))))))).}).))|((((((({...{((((..(((,,(,.,((((,,(((,(((({............},))))).))),.)))),},,..)))..))))))))))))|(((((((((((,{{{{{.,({{{..{(({,,{||(((((....(((((((((........)))))).))).)))))(((((((((((.(((((((((((...((((.{{{.((((...,.(((((((((((.......(({......}}}...))))))).)))).....,.((((.......))))..,,.{{{,......((((((((....)))))))).,||......{{.((((((((((((.(((...))).))....)))))))))).}},..)))).))}.(((..((((((..........))))))...)))..{((((((((((,,{((((((.(((((((.,,..((((...((((((((...,...{{{......}}))}.(((({(,((((((((((((((,((......)})))))))........((((.....)))))).)))))))))))((((((((......))))))))..))))))))...)))).,}...)))).))))))),,,.))).,)))))}.),))))....,)))).))))).))}.......))).)))))))))))..{((((((((((((((((((((.(((......(((((((.(((....))).},))))))....))).)))))))((......))......))))..))))))))))}}))))).....{((((....))))}|||{|........,|||},..}}},,...)))))))))))|,...,,.))))))))))))))))))))).)))))),..))).)))))))))},.......,,......,}}.))))).)))))}...,,))))),)))})))}}))}))))}}.....,{{..(.((((.....)))).)..}}|(((((((((....(((((((((...((((....})))........(((({{{{..|{,.||||...||,|||}},.,|((|........,.,,}},..|||...)))}}}...))))))))))))).))))),..((((((...(((((.,......,,)))))....)))).}}..,,,....}},.......)))))).).))))).)).))))))))).)).,.))))).)).,|}},.))||.,,))))))))))})))})....))))))...((((.((((...((((..((.(((.(......).)))..))..)))))))))))).(((.(((...))).))))))}}))))))).))))}))..}))).,,.,|)))))||||}...|.})}}|||||||||({{,{{(({.{{{{{,.,...{{{....,},))),,||||,}.,}})))))).}}}},||...|{{{,{{((({({(({...|||,,,,}.....}|||},,,,,}{||,{{{{{{,.,{(((((,,,.|||||..(((((((...(((.(((..{(.(((......((((({.((((((((....)))))))),(((.,.(((((.((((((({(((((.(.(((((...,.,,{{{....(((((((......)))))))..,,.))}.))))))))),})).,}))))))).))))).}.)))...,(((....)))))))))......))).}.))).)))....))))))).........|({{,..||.,}))},|||||},.}))))}}}|||||,,..,{{{(((((,({{{{,...{((({...((.((((((((((({..,(,,.......,,.}}}}..)))))))))).}}}}}......,.(({({,..|||}||....,}},}|}|{{{((({(((({(((({{,{,,{,,,.}}})})}}},}})))},.))))))))),,))}}}}}.|||,..{{{{{{{||||{..,{({{,.,||,(((((({{..{((,,,{((,(({({,{((..{{{.,|.|{{{{,.,.|((({{((({{(|{{{|{((((((((((((({...,,,,...{{.{{{{{(,|{{{((....{,|.||}|.(({...{{(|{,.{,,,.(((((((((,,{{.{(({{....({{{{{{...,||.....,)},})))))),,,,.......,,,.,.((((((((({....})))).)))))}|{||||,....,,,})))},|||||||{{{|{|,,,,|{|,,{{{{|(({...,{{{|}|,..,|||((({{{((({,(((.((((,{(,((((,{,,,({{((,,,,.{((((((...,,,,,,.,,,.||}|||,||,}}||}...}))}.)),)))).,}||{||||{,.,,,((((.,,(((.(((((({......}))))))...)))...}}}}.,,,{{||||||,.,|{{{|||||}..,,.||||||,,.{,,,,|||,,,.}))|..||{,}||||}((((((((,({.,{{.||,,,.}}|}))))).}))}}))}.{{{(({,((((({{{{{{,,,..,,,))}}}}),)))),}}..|||||||..|||||}}}}}},......|||,,.,},)|)))}}....,,,,.....|||}.}})),.,.,|}}||||,,.}}}))},}}}.}}..}}||)),)).,,,))}}})|||||..,.,,||||||{|||||,((((((.(((......)))...)))))},{((((((((.................},))))))))||{(,({.((((((((((.,,....((((((({..{(({.|{,{((({(((((....|,|,,{(((((....)))))}.,......}})}..))))))....{({.((((......))))})),,.,})},...)))))))))},,}.)))))),)).))}}|||||||||||||||,.....,..}}))),,},,)),..))))))}((((.((({....................)))).))))||{{(((,,,{.||||||||||,}|}||,|{{|}|||..(((((((({.{....((((((.{{.{......,.}}..))))))...}))))..))))),,}..)))}))}})))),.})))),}))}||,,||||{{{{{((((....}})).}}))}.,))))}}))|||(((((((((.,{{..((((((,{,,....{{({{((((..........,{(((((({..........,...)))))))|{((..,..,,}..))),}))).)})))||||,,||||,||.(((,(({{((.(((......))).))),))),})),|||||,,..,},))))))))..}),.)))))))))}.))}}},,.}}},,)))))).....,,,,))}.},,)))..)),))})))..,,))})))))))))}))).,||,}}}||....{{{{{{{.,,))))))),..{||{..,,{,....,}...))))...,,,||,......,..)))))},}}}|}}|||||||,||{{{..,.}}}}}.}})}}}},,||.{{(({||.....,)))},)))),....

Transcripts

ID Sequence Length GC content
AUCCCGGCGCAAUGGAGUUCUCCGAAGGGCGAUGAUUCCAGCCACAUCU… 4421 nt 0.5426
Summary

Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that chronic cocaine exposure and withdrawal induced profound transcriptomic changes in the nucleus accumbens, with adenylate cyclase 8 (Adcy8) showing a transient increase in expression specifically during cocaine administration [Eipper-Mains et al. DOI:10.1111/J.1601-183X.2012.00873.X]. A study in mice demonstrated that ADCY8 is expressed in greater quantity in the nucleus accumbens core in males than in females [Hitzemann et al. DOI:10.1016/J.Biopsych.2021.04.016].