Basic Information

Symbol
COPS5
RNA class
mRNA
Alias
COP9 Signalosome Subunit 5 JAB1 SGN5 CSN5 MOV-34 Jun Activation Domain-Binding Protein 1 COP9 Signalosome Complex Subunit 5 Signalosome Subunit 5 COP9 (Constitutive Photomorphogenic, Arabidopsis, Homolog) Subunit 5 COP9 Constitutive Photomorphogenic Homolog Subunit 5 (Arabidopsis) COP9 Constitutive Photomorphogenic Homolog Subunit 5 Testis Secretory Sperm-Binding Protein Li 231m 38 KDa Mov34 Homolog EC 3.4.-.-
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_006837.3
Sequence length
1296.0 nt
GC content
0.4398

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-375.50 kcal/mol
Thermodynamic ensemble
Free energy: -400.43 kcal/mol
Frequency: 0.0000
Diversity: 397.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((....)).)))..((((((.((((..((.((((((.(((..(((((.((((.(((...(((.(((((((........((((((.((((((((((((.......)))))).))))))..((((((((.((.((....)).))...)))))))).....(((((.....)))))....(((((((...((((((..((((..((((((........((((((...................((.((.....)).))(((((((((((((.(...((((..((((((((((((((..((((..(((((((((.......))))).)))).....))))((((.........)))))))).))))))))))))))...))))))((((.((.(((((((........)))))))...)).))))))))))))))))))(((........)))......)))))).)))).)))))).............(((((.........)))))......))))))))))))).........)))))))....((((((((...))))))))((((((((.((((((((((((.((((((((......)))).)).)).)))))))))))))))...))))).((((..((((.((......)).))))..)))).)))....))).)))).)))))....((......))...)))..))))))))))))....(((((((((.(((((((...(((((...........))))).(((((((((.(((.((((.........((((....((....((((((((.((((.(((....(((((.(((...)))...((((.((((((...........(((...(((((((..(((((.((((((((........))(((((..(((...)))..)))))((((((..(((((....)))))..))))))(((((((((((((((......)))))).)))))))))......(((........................)))..)))))).))))).)))).)))..))).)))))).))))))))).)))))))((((((((((((((..(((...(((((((((...............))))))))).)))....))))....))))))..))))))))))))....)).....))))...........))))))))))))))))..............))))))).)))).)))))...(((((........)))))..))))))..........
Thermodynamic Ensemble Prediction
.,,..{{.{(({{...,,,.,)}}),....{((((((((((((((.(((.....((((((..((({.,.((((((.{(({..,,}||}.((((((((((((.......)))))).))))))..{((((.{{....,,..})})),})))))).}.))).)))))).....)))))))))),(,,...,...,{((((((.((({{{{(({((..,....{{{,................,,{{,{(..,...{{{|{({{{{.,,|||(({{.,...({(({,((((((((((((((..,{({..(((((((((.......)))))},))),,}}.)}),{{((.....,,.,}))}})))}}}})))))))||}}|.,|))}}},.{((({{(((((,...||||,|}},}}},,}..,{.((((({((.(((((({{(((........)))((((....))))..{{((({(({,(((....|,|||,{((({.........)})))...},,|},.||||||,,|{.....,..}}|||}|||..((((((({...}))))))){(({{(((,{{((((((((((.{{,|{{{{,...,.}))).,,.)),)))))))))))},)),.})))))}||{(,.{(((.{{...,..}}.)}}}.}))))})).)))))))}.)}|{,,{(((((.((......)),)))))),.,,.,}}||||}}}..||||{{{{(,({{{{{|,,}||,{{,,,,,,.....,,||..(((((((((.(((.((((..........||{|,..,,,...((((((((,{{,,{(((....{||||.(({...}))...{(((,{(((((........,{{({{,..(({((((..{((((.((((((((........))|((((,.,,,..|)))}.||||{((((((,.(((((....})))).,}}}}},(((((((((((((((......)))))).)))))))))......}}.,}}},.....}},,,,},,...,,}},..}))))).))))}.)))),))}...}},))}))}.}))}})))).)))}}}}{(((((((((((((..(((...(((((((((...............))))))))).)))....}}}}....)))))}.,))))))))))))....,,.....)}},...........))))))))))))))))..,}}},..,....))))))),)))),}))))...,,,,....,}}}}))...)))))))}..........

Transcripts

ID Sequence Length GC content
AGGUGUCAUGGCUGCCCCAAGAGUCUAGGUAAGAGUUUGUUCCCGUGGU… 1296 nt 0.4398
Summary

The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein is reported to be involved in the degradation of cyclin-dependent kinase inhibitor CDKN1B/p27Kip1. It is also known to be an coactivator that increases the specificity of JUN/AP1 transcription factors. [provided by RefSeq, Jul 2008]

Forensic Context

A review of multi-omics studies for human biological age estimation identified the COPS5 as an aging-associated transcriptome feature, where its expression was correlated with age in the Framingham Offspring cohort [Solovev et al. DOI:10.1016/j.mad.2019.111192].