| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGUGUCAUGGCUGCCCCAAGAGUCUAGGUAAGAGUUUGUUCCCGUGGU… | 1296 nt | 0.4398 |
The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein is reported to be involved in the degradation of cyclin-dependent kinase inhibitor CDKN1B/p27Kip1. It is also known to be an coactivator that increases the specificity of JUN/AP1 transcription factors. [provided by RefSeq, Jul 2008]
A review of multi-omics studies for human biological age estimation identified the COPS5 as an aging-associated transcriptome feature, where its expression was correlated with age in the Framingham Offspring cohort [Solovev et al. DOI:10.1016/j.mad.2019.111192].