Basic Information

Symbol
COX7C
RNA class
mRNA
Alias
Cytochrome C Oxidase Subunit 7C Cytochrome C Oxidase Subunit 7C, Mitochondrial Cytochrome C Oxidase Polypeptide VIIc Cytochrome C Oxidase Subunit VIIc Cytochrome-C Oxidase Chain VIIc
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis

MANE select

Transcript ID
NM_001867.3
Sequence length
629.0 nt
GC content
0.4070

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-161.90 kcal/mol
Thermodynamic ensemble
Free energy: -174.31 kcal/mol
Frequency: 0.0000
Diversity: 184.11
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((.(((((..(......)..))))).).))))))..(((((((((((((((((....))))))))((.(((((((.(((((((.....)))))))...((((((......))))))((....))....(((((((...)))))))(((((((...))).)))).))))))).)).(((((((((((((((....(((((((....((((.....((((((..((((((...((((((((....((((.......((((((((........))))))))......(((((....((((((....)))))))))))..))))....))))))))......((((((.((((((...)))))).))))))..(((((..(((...(((..((..(((...(((.(((((....))))).)))...)))...))...)))..)))..))))).(((((((..((((((.((((....(((((((..(....)..)))))))....)))))))))))))))))...))))))....))))))))))..)))))))......)))))))....)))))))).)))))))))......................................
Thermodynamic Ensemble Prediction
.{((((((.(((((..(....,.)..))))).}.))))}}...{.((((((((,{((((..{{|||||,,,((.(((((((.(((((((.....))))))},,,((((((......))))))|,...,))....(((((((...)))))))(((((((...}),,)))).))))))).)){((((((((,,,,,,..,.|||||}},}).....}}}}}}|,}|||}}.|}}}}}}},|(((({(,..,{{{,..,,,.,((((((((........)))))))}|..{,{((({(....((((((....))))))}))),{{{{,,{{{{{||,||||{{,{,,((((({.((((((...)))))).))))))..{{,,,..,||..,||||,{{{{{..,,{(((.{{{{({{,.,|....}})}}}},,...||.....)}.}},..,,,}}.(((((((..(((((,,((((....(((((((..,....}..)))))))....)))))))))))))))))...,,})),},}}))}})}))))))).,))))......,|||,||{{{{||}}},))))))))}))}}|}}}}..,,,.,.,,,,,,}}}}},,.,}},,,,...

Transcripts

ID Sequence Length GC content
CUUUUCAGUCCUUGCGCACCGGGGAACAAGGUCGUGAAAAAAAAGGUCU… 629 nt 0.4070
Summary

Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes subunit VIIc, which shares 87% and 85% amino acid sequence identity with mouse and bovine COX VIIc, respectively, and is found in all tissues. A pseudogene COX7CP1 has been found on chromosome 13. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the COX7C as a mitochondrial-associated core gene through RNA sequencing and bioinformatics analysis of peripheral blood from sepsis patients and healthy controls [Li et al. DOI:10.1186/s12920-024-01891-x]. In a separate review of mouse and human studies on myocardial infarction, the COX7C was characterized as a marker for high-energy metabolic cardiomyocytes, being enriched in a specific ventricular cardiomyocyte cluster [Bian et al. DOI:10.3892/mmr.2025.13680].