| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUCAGUCCUUGCGCACCGGGGAACAAGGUCGUGAAAAAAAAGGUCU… | 629 nt | 0.4070 |
Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes subunit VIIc, which shares 87% and 85% amino acid sequence identity with mouse and bovine COX VIIc, respectively, and is found in all tissues. A pseudogene COX7CP1 has been found on chromosome 13. [provided by RefSeq, Jul 2008]
A study in humans identified the COX7C as a mitochondrial-associated core gene through RNA sequencing and bioinformatics analysis of peripheral blood from sepsis patients and healthy controls [Li et al. DOI:10.1186/s12920-024-01891-x]. In a separate review of mouse and human studies on myocardial infarction, the COX7C was characterized as a marker for high-energy metabolic cardiomyocytes, being enriched in a specific ventricular cardiomyocyte cluster [Bian et al. DOI:10.3892/mmr.2025.13680].