Basic Information

Symbol
CREB3
RNA class
mRNA
Alias
CAMP Responsive Element Binding Protein 3 Luman LZIP SLZIP Cyclic AMP-Responsive Element-Binding Protein 3 Transcription Factor LZIP-Alpha Small Leucine Zipper Protein Cyclic AMP Response Element (CRE)-Binding Protein/Activating Transcription Factor 1 CAMP Responsive Element Binding Protein 3 (Luman) CAMP-Responsive Element-Binding Protein 3 Basic Leucine Zipper Protein Leucin Zipper Proitein Leucine Zipper Protein CREB-3
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_006368.5
Sequence length
1496.0 nt
GC content
0.5455

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-561.10 kcal/mol
Thermodynamic ensemble
Free energy: -586.89 kcal/mol
Frequency: 0.0000
Diversity: 304.30
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((.......(((((.(.((((.(((((.......))))).)))).).)))))((((((((.....))))))))(((((((((((((((.((((((.....(((..((((..((....(((.((((((((((((((.(((((((..(((((.....)))))(((((....(((((.......)))))...((((.....)))))))))((((.(((((.((((.(.....).))))..(((.(((((((((((.((((((..((((.((((......))))....))))))))))..)).))))))).))))).......))))).))))((((((.((........((((......))))....((((((.....((((.((........)).)))).....))))))((((..(((((..(..(((.((..((.((((((..(((((....)))))..)))))).))..)).)))..)....)))))..))))...(((((((((..(((((((((..((..(((((((((((.....(((((.......)))))......))).))))))))..)).......(((((((((((...(((.((.(((.(.............).))).)).)))...))))).)))))).........((((((.....))).)))(((((((........).)))))))))..))))))..))))))))).........(((....)))..)).))))))..((((....))))......)))))))..((((...)))).))))))))..)))))).))).....))..))))))).....)))))).........((((((..(((((((((((.(((.(.(((.(((((((((((...((((((..(((.((((......)))).....))).))))))((..(((((....((((((.((...((((.....((((.(((....)))))))..)))))).))))))......)))))..))))))))))))).)))).)))))).......(((((((((((...(((.(((.((((((.(((((....)))))..((((((....(((((...)))))..))))))(((((((((((((..((......))....)))..))))))))))..((((.....(((((..((((((.........))))))......)))))......)))).....)))))).))).))))))))))))))))))))))...)))))).......)))).)))))))..((((((....)))))).((.((((..((((.....)))))))).))....)))).((((((((..(((((((((((........).)))))((((.....))))(((.(......).))).........((.((((((((((.............)))))))...))).)))))))..))...)))))).))))).
Thermodynamic Ensemble Prediction
.{(((({{.,,.,(((((.(.((((.(((((.......))))).)))).).))))}((((((((,....))))))))(((((((((((((({.((((((.{|..{{,..((((.,(({,..(((.((((((((((((((.(((((((,.(((((.....))))}{((((....(((((.......)))))...((((.....))))))))),,,({{(({((((..((((((((((((.(((.....(((((..((..,{.....(((.(((((..,.(((((.((((((((((,{{{{{....,.})}||,,{,,,..(((((.((((.((((....{{{.........((((,,..,,||}}..,,,{{(((({,,.{{||,||,...,,,.))))))}...})))))..,{{,..{{((({.{..((,.((..((.((((((..(((((....)))))..)))))).))..)).,)).,),}..)})))...)))}.}})))))))||,.((((((.,{,(,..(((((((((((.....(((((.......)))))......))).)))))))).,))..............((((....)))).))))))...,}..,,,}.))))))))))))))).))))).)))......,).,}}..)))))....))).))))))))}..,))).)))).((((((((.(((,...,))).))}})))))....{{(((....)))}))})).|}}|{.((((....)))).}....)))))))..((((...)))).))))))))..)))))).))),}},|}),,),|||}}..,,.)))))).........((((((..((((((((((,{(((.(.(((.(((((((((((...((((((..{,(.((((......)))).....,}}.)))))){(..(((((...,((((((.((...((((.....((((.(((....)))))))..)))))).))))))}.....)))))..}}))))))))))).)))).)))))).......(((((((((((...(((.((({((((((.(((((....)))))..((((((....(((((...)))))..))))))(((((((((((((..,(,.....}),...)))..))))))))))..((((...,.(((((..((((((.........))))))......)))))......)))).....)))))).))).))))))))))))))))))))))...)))))).......}))).))))))).|((((((....))))})}|(.((((,.{(((.....)))))))).)}....)))).{{{{{{,{..||{|||(((((..,,,,,,|,,||||,(((.,..,||},,,,,|}..,|,}.}))}.....,..((.((((((((({,{..........}))))))}..}))).)))}}})..)),,,))))}).}))}}.

Transcripts

ID Sequence Length GC content
GUAGAGGGACAGUGGAUAGGUGCCCGAGGCCUACAGCUGGCCUGGGGCU… 1496 nt 0.5455
Summary

This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds to the cAMP-response element and regulates cell proliferation. The protein interacts with host cell factor C1, which also associates with the herpes simplex virus (HSV) protein VP16 that induces transcription of HSV immediate-early genes. This protein and VP16 both bind to the same site on host cell factor C1. It is thought that the interaction between this protein and host cell factor C1 plays a role in the establishment of latency during HSV infection. This protein also plays a role in leukocyte migration, tumor suppression, and endoplasmic reticulum stress-associated protein degradation. Additional transcript variants have been identified, but their biological validity has not been determined.[provided by RefSeq, Nov 2009]

Forensic Context

A study in mice demonstrated that chronic cocaine exposure and withdrawal induced sustained decreases in the expression of the CREB3 gene in the nucleus accumbens, as part of broad transcriptional changes affecting heterotrimeric G-protein signaling pathways [Eipper-Mains et al. DOI:10.1111/J.1601-183X.2012.00873.X].