| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUGCCUCGGAACUGGACCCGGGAGACAUCACAGCGCUGGGCUAGGG… | 672 nt | 0.6354 |
Cysteine-rich intestinal protein (CRIP) belongs to the LIM/double zinc finger protein family, members of which include cysteine- and glycine-rich protein-1 (CSRP1; MIM 123876), rhombotin-1 (RBTN1; MIM 186921), rhombotin-2 (RBTN2; MIM 180385), and rhombotin-3 (RBTN3; MIM 180386). CRIP may be involved in intestinal zinc transport (Hempe and Cousins, 1991 [PubMed 1946385]).[supplied by OMIM, Mar 2008]
A review of human studies summarizing multi-omics approaches for biological age estimation identified the CRIP1 as a transcriptomic feature positively associated with aging in whole blood samples from a cohort of healthy people [Solovev et al. DOI:10.1016/j.mad.2019.111192].